Быстрый заказ

Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса EIF3G Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001013095.1
    Размер кДНК:963bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus eukaryotic translation initiation factor 3, subunit G.
    Синоним гена:Eif3s4
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EIF3G qPCR primers for gene expression analysis, RP300985 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81021-ACGRBS15400
    Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81021-ACRRBS15400
    Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81021-ANGRBS15400
    Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81021-ANRRBS15400
    Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81021-CFRBS13340
    Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81021-CHRBS13340
    Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81021-CMRBS13340
    Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81021-CYRBS13340
    Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81021-NFRBS13340
    Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81021-NHRBS13340
    Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81021-NMRBS13340
    Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81021-NYRBS13340
    Крыса EIF3G/EIF3S4 Джин клон кДНК в вектор клонированияRG81021-URBS5130
    Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмидыRG81021-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».