After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat EIF3G Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001013095.1
Размер кДНК:963bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus eukaryotic translation initiation factor 3, subunit G.
Синоним гена:Eif3s4
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81021-ACGRBS15400
Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81021-ACRRBS15400
Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81021-ANGRBS15400
Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81021-ANRRBS15400
Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81021-CFRBS13340
Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81021-CHRBS13340
Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81021-CMRBS13340
Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81021-CYRBS13340
Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81021-NFRBS13340
Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81021-NHRBS13340
Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81021-NMRBS13340
Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81021-NYRBS13340
Крыса EIF3G/EIF3S4 Джин клон кДНК в вектор клонированияRG81021-URBS5130
Крыса EIF3G/EIF3S4 Джин ORF экспрессии кДНК клона плазмидыRG81021-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81021-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».