Быстрый заказ

Крыса ECHDC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса ECHDC1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001007734.1
    Размер кДНК:900bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus enoyl CoA hydratase domain containing 1 with N terminal HA tag.
    Синоним гена:MMCD
    Виды:Rat
    переносчик:pCMV3-N-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ECHDC1 qPCR primers for gene expression analysis, RP300456 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Крыса ECHDC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Крыса ECHDC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80492-ACGRBS15400
    Крыса ECHDC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80492-ACRRBS15400
    Крыса ECHDC1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80492-ANGRBS15400
    Крыса ECHDC1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80492-ANRRBS15400
    Крыса ECHDC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80492-CFRBS13340
    Крыса ECHDC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80492-CHRBS13340
    Крыса ECHDC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80492-CMRBS13340
    Крыса ECHDC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80492-CYRBS13340
    Крыса ECHDC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80492-NFRBS13340
    Крыса ECHDC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80492-NHRBS13340
    Крыса ECHDC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80492-NMRBS13340
    Крыса ECHDC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80492-NYRBS13340
    Крыса ECHDC1 Джин клон кДНК в вектор клонированияRG80492-URBS5130
    Крыса ECHDC1 Джин ORF экспрессии кДНК клона плазмидыRG80492-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».