After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса ECH1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ECH1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_022594.1
Размер кДНК:984bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus enoyl CoA hydratase 1, peroxisomal with N terminal Myc tag.
Синоним гена:Pxel
Виды:Rat
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса ECH1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса ECH1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80709-ACGRBS15396
Крыса ECH1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80709-ACRRBS15396
Крыса ECH1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80709-ANGRBS15396
Крыса ECH1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80709-ANRRBS15396
Крыса ECH1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80709-CFRBS13343
Крыса ECH1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80709-CHRBS13343
Крыса ECH1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80709-CMRBS13343
Крыса ECH1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80709-CYRBS13343
Крыса ECH1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80709-NFRBS13343
Крыса ECH1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80709-NHRBS13343
Крыса ECH1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80709-NMRBS13343
Крыса ECH1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80709-NYRBS13343
Крыса ECH1 Джин клон кДНК в вектор клонированияRG80709-URBS5132
Крыса ECH1 Джин ORF экспрессии кДНК клона плазмидыRG80709-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

ECH1 is a member of the hydratase/isomerase superfamily. ECH1 shows high sequence similarity to enoyl-CoA hydratases of several species, particularly within a conserved domain characteristic of these proteins. ECH1 contains a C-terminal peroxisomal targeting sequence and localizes to peroxisomes. The rat ortholog, which localizes to the matrix of both the peroxisome and mitochondria, can isomerize 3-trans, 5-cis-dienoyl-CoA to 2-trans,4-trans-dienoyl-CoA, indicating that it is a delta3,5-delta2,4-dienoyl-CoA isomerase. ECH1 functions in the auxiliary step of the fatty acid beta-oxidation pathway. Expression of the rat gene is induced by peroxisome proliferators.

Ссылки
  • Kovalyov LI, et al. (2006) Polymorphism of delta3,5-delta2,4-dienoyl-coenzyme A isomerase (the ECH1 gene product protein) in human striated muscle tissue. Biochemistry Mosc. 71(4): 448-53.
  • Olsen JV, et al. (2006) Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell. 127(3):635-48.
  • FitzPatrick DR, et al. (1995) Isolation and characterization of rat and human cDNAs encoding a novel putative peroxisomal enoyl-CoA hydratase. Genomics. 27(3):457-66.
  • Size / Price
    Каталог: RG80709-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».