Быстрый заказ

Text Size:AAA

Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat DSG4 Информация о продукте «Клон cDNA»
Размер кДНК:3123bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus desmoglein 4 with C terminal His tag.
Синоним гена:Dsg4
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80273-ACGRBS22240
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80273-ACRRBS22240
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80273-CFRBS20190
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80273-CHRBS20190
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80273-CMRBS20190
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80273-CYRBS20190
Крыса DSG4/Desmoglein 4 Джин клон кДНК в вектор клонированияRG80273-GRBS5130
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80273-NFRBS20190
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80273-NHRBS20190
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80273-NMRBS20190
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80273-NYRBS20190
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмидыRG80273-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80273-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.