After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat DSG4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_199490.1
Размер кДНК:3123bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus desmoglein 4 with C terminal His tag.
Синоним гена:Dsg4
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80273-ACGRBS22240
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80273-ACRRBS22240
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80273-CFRBS20190
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80273-CHRBS20190
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80273-CMRBS20190
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80273-CYRBS20190
Крыса DSG4/Desmoglein 4 Джин клон кДНК в вектор клонированияRG80273-GRBS5130
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80273-NFRBS20190
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80273-NHRBS20190
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80273-NMRBS20190
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80273-NYRBS20190
Крыса DSG4/Desmoglein 4 Джин ORF экспрессии кДНК клона плазмидыRG80273-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80273-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».