After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса DSCR3 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat DSCR3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001108316.2
Размер кДНК:894bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Down syndrome critical region gene 3.
Синоним гена:Dscr3
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса DSCR3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса DSCR3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81009-ACGRBS15400
Крыса DSCR3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81009-ACRRBS15400
Крыса DSCR3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81009-ANGRBS15400
Крыса DSCR3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81009-ANRRBS15400
Крыса DSCR3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81009-CFRBS13340
Крыса DSCR3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81009-CHRBS13340
Крыса DSCR3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81009-CMRBS13340
Крыса DSCR3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81009-CYRBS13340
Крыса DSCR3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81009-NFRBS13340
Крыса DSCR3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81009-NHRBS13340
Крыса DSCR3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81009-NMRBS13340
Крыса DSCR3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81009-NYRBS13340
Крыса DSCR3 Джин клон кДНК в вектор клонированияRG81009-URBS5130
Крыса DSCR3 Джин ORF экспрессии кДНК клона плазмидыRG81009-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81009-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».