Desmocollin 2 / DSC2 cDNA ORF Clone, Rat, C-His tag

Price:
Size:
Number:

Desmocollin 2 / DSC2 cDNA ORF Clone, Rat, C-His tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2709 bp
Description
Full length Clone DNA of Rat desmocollin 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Desmocollin 2 / DSC2 Background Information

DSC2 is a calcium-dependent glycoprotein that is a member of the desmocollin subfamily of the cadherin superfamily. Like other desmocollins, murine DSC2 has two products, Dsc2a and Dsc2b, produced by alternative splicing of a 46 bp exon which encodes 11 COOH-terminal aa followed by an in-frame stop codon. These desmosomal family members, along with the desmogleins, are found primarily in epithelial cells where they constitute the adhesive proteins of the desmosome cell-cell junction and are required for cell adhesion and desmosome formation. The desmosomal family members are arranged in two clusters on chromosome 18, occupying less than 65 kb combined. Mutations in DSC2 are associated with arrhythmogenic right ventricular dysplasia-11. DSC2 is Involved in the interaction of plaque proteins and intermediate filaments mediating cell-cell adhesion. DSC2 may contribute to epidermal cell positioning by mediating differential adhesiveness between cells that express different isoforms.
Full Name
desmocollin 2
References
  • Nuber UA, et al. (1995) The widespread human desmocollin Dsc2 and tissue-specific patterns of synthesis of various desmocollin subtypes. Eur J Cell Biol. 66 (1): 69-74.
  • Marsden MD, et al. (1997) Cloning and transcriptional analysis of the promoter of the human type 2 desmocollin gene (DSC2). Gene. 186 (2): 237-47.
  • Greenwood MD, et al. (1997) Exon-intron organization of the human type 2 desmocollin gene (DSC2): desmocollin gene structure is closer to "classical" cadherins than to desmogleins. Genomics. 44 (3): 330-5.

Desmocollin 2 / DSC2 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait