Быстрый заказ

Крыса DSC2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat DSC2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001033688.1
Размер кДНК:2709bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus desmocollin 2 with C terminal His tag.
Синоним гена:Dsc2
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса DSC2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса DSC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80266-ACGRBS22240
Крыса DSC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80266-ACRRBS22240
Крыса DSC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80266-CFRBS20190
Крыса DSC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80266-CHRBS20190
Крыса DSC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80266-CMRBS20190
Крыса DSC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80266-CYRBS20190
Крыса DSC2 Джин клон кДНК в вектор клонированияRG80266-GRBS5130
Крыса DSC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80266-NFRBS20190
Крыса DSC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80266-NHRBS20190
Крыса DSC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80266-NMRBS20190
Крыса DSC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80266-NYRBS20190
Крыса DSC2 Джин ORF экспрессии кДНК клона плазмидыRG80266-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

DSC2 is a calcium-dependent glycoprotein that is a member of the desmocollin subfamily of the cadherin superfamily. Like other desmocollins, murine DSC2 has two products, Dsc2a and Dsc2b, produced by alternative splicing of a 46 bp exon which encodes 11 COOH-terminal aa followed by an in-frame stop codon. These desmosomal family members, along with the desmogleins, are found primarily in epithelial cells where they constitute the adhesive proteins of the desmosome cell-cell junction and are required for cell adhesion and desmosome formation. The desmosomal family members are arranged in two clusters on chromosome 18, occupying less than 650 kb combined. Mutations in DSC2 are associated with arrhythmogenic right ventricular dysplasia-11. DSC2 is Involved in the interaction of plaque proteins and intermediate filaments mediating cell-cell adhesion. DSC2 may contribute to epidermal cell positioning by mediating differential adhesiveness between cells that express different isoforms.

Ссылки
  • Nuber UA, et al. (1995) The widespread human desmocollin Dsc2 and tissue-specific patterns of synthesis of various desmocollin subtypes. Eur J Cell Biol. 66 (1): 69-74.
  • Marsden MD, et al. (1997) Cloning and transcriptional analysis of the promoter of the human type 2 desmocollin gene (DSC2). Gene. 186 (2): 237-47.
  • Greenwood MD, et al. (1997) Exon-intron organization of the human type 2 desmocollin gene (DSC2): desmocollin gene structure is closer to "classical" cadherins than to desmogleins. Genomics. 44 (3): 330-5.
  • Size / Price
    Каталог: RG80266-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».