Быстрый заказ

Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса DDX18 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001006996.1
    Размер кДНК:2025bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus DEAD (Asp-Glu-Ala-Asp) box polypeptide 18.
    Синоним гена:Ddx18
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DDX18 qPCR primers for gene expression analysis, RP301003 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81039-ACGRBS16760
    Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81039-ACRRBS16760
    Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81039-ANGRBS16760
    Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81039-ANRRBS16760
    Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81039-CFRBS14710
    Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81039-CHRBS14710
    Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81039-CMRBS14710
    Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81039-CYRBS14710
    Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81039-NFRBS14710
    Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81039-NHRBS14710
    Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81039-NMRBS14710
    Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81039-NYRBS14710
    Крыса DDX18 Джин клон кДНК в вектор клонированияRG81039-URBS5130
    Крыса DDX18 Джин ORF экспрессии кДНК клона плазмидыRG81039-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG81039-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».