Быстрый заказ

Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat DDX18 Информация о продукте «Клон cDNA»
Размер кДНК:2025bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 with C terminal His tag.
Синоним гена:Ddx18
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81039-ACGRBS16760
Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81039-ACRRBS16760
Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81039-ANGRBS16760
Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81039-ANRRBS16760
Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81039-CFRBS14710
Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81039-CHRBS14710
Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81039-CMRBS14710
Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81039-CYRBS14710
Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81039-NFRBS14710
Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81039-NHRBS14710
Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81039-NMRBS14710
Крыса DDX18 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81039-NYRBS14710
Крыса DDX18 Джин клон кДНК в вектор клонированияRG81039-URBS5130
Крыса DDX18 Джин ORF экспрессии кДНК клона плазмидыRG81039-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81039-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.