Быстрый заказ

Крыса DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса DDR2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_031764.3
    Размер кДНК:2565bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus discoidin domain receptor tyrosine kinase 2 with C terminal HA tag.
    Синоним гена:Tyro10, Ddr2
    Виды:Rat
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DDR2 qPCR primers for gene expression analysis, RP300311 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Крыса DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Крыса DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80341-ACGRBS22240
    Крыса DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80341-ACRRBS22240
    Крыса DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80341-CFRBS20190
    Крыса DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80341-CHRBS20190
    Крыса DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80341-CMRBS20190
    Крыса DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80341-CYRBS20190
    Крыса DDR2/CD167b Джин клон кДНК в вектор клонированияRG80341-GRBS5130
    Крыса DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80341-NFRBS20190
    Крыса DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80341-NHRBS20190
    Крыса DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80341-NMRBS20190
    Крыса DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80341-NYRBS20190
    Крыса DDR2/CD167b Джин ORF экспрессии кДНК клона плазмидыRG80341-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Discoidin domain receptor 2 (DDR2) or CD167b (cluster of differentiation 167b) is a kind of protein tyrosine kinases associated with cell proliferation and tumor metastasis, and collagen, identified as a ligand for DDR2, up-regulates matrix metallloproteinase 1 (MMP-1) and MMP-2 expression in cellular matrix. DDR2/CD167b was found to recognise the triple-helical region of collagen X as well as the NC1 domain. Binding to the collagenous region was dependent on the triple-helical conformation. DDR2/CD167b autophosphorylation was induced by the collagen X triple-helical region but not the NC1 domain, indicating that the triple-helical region of collagen X contains a specific DDR2 binding site that is capable of receptor activation. DDR2/CD167b is induced during stellate cell activation and implicate the phosphorylated receptor as a mediator of MMP-2 release and growth stimulation in response to type I collagen. Moreover, type I collagen-dependent upregulation of DDR2/CD167b expression establishes a positive feedback loop in activated stellate cells, leading to further proliferation and enhanced invasive activity.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Ссылки
  • Olaso E, et al. (2001) DDR2 receptor promotes MMP-2-mediated proliferation and invasion by hepatic stellate cells. J Clin Invest. 108(9): 1369-78.
  • Zhang W, et al. (2006) Expression of discoidin domain receptor 2 (DDR2) extracellular domain in pichia pastoris and functional analysis in synovial fibroblasts and NIT3T3 cells. Mol Cell Biochem. 290(1-2): 43-53.
  • Leitinger B, et al. (2006) The discoidin domain receptor DDR2 is a receptor for type X collagen. Matrix Biol. 25(6): 355-64.
  • Leitinger B, et al. (2004) The D2 period of collagen II contains a specific binding site for the human discoidin domain receptor, DDR2. J Mol Biol. 344(4): 993-1003.
  • Size / Price
    Каталог: RG80341-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».