After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса DAD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat DAD1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_138910.3
Размер кДНК:342bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus defender against cell death 1 with N terminal Myc tag.
Синоним гена:Dad1
Виды:Rat
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса DAD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса DAD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80700-ACGRBS15400
Крыса DAD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80700-ACRRBS15400
Крыса DAD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80700-CFRBS13340
Крыса DAD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80700-CHRBS13340
Крыса DAD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80700-CMRBS13340
Крыса DAD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80700-CYRBS13340
Крыса DAD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80700-NFRBS13340
Крыса DAD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80700-NHRBS13340
Крыса DAD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80700-NMRBS13340
Крыса DAD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80700-NYRBS13340
Крыса DAD1 Джин клон кДНК в вектор клонированияRG80700-URBS5130
Крыса DAD1 Джин ORF экспрессии кДНК клона плазмидыRG80700-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80700-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».