Быстрый заказ

Text Size:AAA

Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CXCR4 Информация о продукте «Клон cDNA»
Размер кДНК:1050bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus chemokine (C-X-C motif) receptor 4 with N terminal His tag.
Синоним гена:MGC108696, Cxcr4
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80342-ACGRBS15396
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80342-ACRRBS15396
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80342-ANGRBS15396
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80342-CFRBS13343
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80342-CHRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80342-CMRBS13343
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80342-CYRBS13340
Крыса CXCR4 Джин клон кДНК в вектор клонированияRG80342-GRBS5132
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80342-NFRBS13343
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80342-NHRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80342-NMRBS13343
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80342-NYRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмидыRG80342-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80342-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.