Быстрый заказ

Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Крыса CXCR4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_022205.3
Размер кДНК:1050bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus chemokine (C-X-C motif) receptor 4 with N terminal His tag.
Синоним гена:MGC108696, Cxcr4
Виды:Rat
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CXCR4 qPCR primers for gene expression analysis, RP300312 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80342-ACGRBS15400
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80342-ACRRBS15400
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80342-ANGRBS15400
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80342-CFRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80342-CHRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80342-CMRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80342-CYRBS13340
Крыса CXCR4 Джин клон кДНК в вектор клонированияRG80342-GRBS5130
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80342-NFRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80342-NHRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80342-NMRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80342-NYRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмидыRG80342-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80342-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».