Быстрый заказ

Text Size:AAA

Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CXCR4 Информация о продукте «Клон cDNA»
Размер кДНК:1050bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus chemokine (C-X-C motif) receptor 4 with C terminal HA tag.
Синоним гена:MGC108696, Cxcr4
Участок рестрикции:KpnI + XbaI (6kb + 1.09kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Rat CXCR4 Gene Plasmid Map
Rat CXCR4 ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80342-ACGRBS15400
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80342-ACRRBS15400
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80342-ANGRBS15400
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80342-CFRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80342-CHRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80342-CMRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80342-CYRBS13340
Крыса CXCR4 Джин клон кДНК в вектор клонированияRG80342-GRBS5130
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80342-NFRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80342-NHRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80342-NMRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80342-NYRBS13340
Крыса CXCR4 Джин ORF экспрессии кДНК клона плазмидыRG80342-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80342-CY
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Rat CXCR4 ORF mammalian expression plasmid, C-HA tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.