CXCL17 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Price:
Size:
Number:

CXCL17 cDNA ORF Clone, Rat, N-DDK (Flag®) tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
360 bp
Description
Full length Clone DNA of Rat chemokine (C-X-C motif) ligand 17 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CXCL17 Background Information

Chemokine (C-X-C motif) ligand 17 (CXCL17) is the latest member of the chemokine family. CXCL17 is a potential oncogene and promising therapeutic target, is an independent biomarker of poor prognosis in patients with breast cancer, and can promote proliferation and migration of breast cancer cells in vitro and in vivo. CXCL17 is expressed in a variety of cancers and promotes tumor progression by recruiting myeloid-derived suppressor cells (MDSCs). CXCL17 attenuates IMQ-induced psoriasis-like skin inflammation by recruiting MDSCs and Tregs, which may be important for regulating excessive inflammation in psoriasis skin. CXCL17 production correlated with adverse immune infiltration and might be an important target for anti-HCC therapies. CXCL17 is a major regulator of mucosal inflammatory responses.
Full Name
chemokine (C-X-C motif) ligand 17
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait