After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса Fractalkine/CX3CL1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CX3CL1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_134455.1
Размер кДНК:1182bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus chemokine (C-X3-C motif) ligand 1 with N terminal Flag tag.
Синоним гена:Cx3c, Scyd1, Cx3cl1
Виды:Rat
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса Fractalkine/CX3CL1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса Fractalkine/CX3CL1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80163-ACGRBS15400
Крыса Fractalkine/CX3CL1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80163-ACRRBS15400
Крыса Fractalkine/CX3CL1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80163-CFRBS13340
Крыса Fractalkine/CX3CL1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80163-CHRBS13340
Крыса Fractalkine/CX3CL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80163-CMRBS13340
Крыса Fractalkine/CX3CL1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80163-CYRBS13340
Крыса Fractalkine/CX3CL1 Джин клон кДНК в вектор клонированияRG80163-GRBS5130
Крыса Fractalkine/CX3CL1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80163-NFRBS13340
Крыса Fractalkine/CX3CL1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80163-NHRBS13340
Крыса Fractalkine/CX3CL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80163-NMRBS13340
Крыса Fractalkine/CX3CL1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80163-NYRBS13340
Крыса Fractalkine/CX3CL1 Джин ORF экспрессии кДНК клона плазмидыRG80163-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Fractalkine or Chemokine (C-X3-C motif) ligand 1 (CX3CL1) is a member of the CX3C chemokine family. Fractalkine / CX3CL1 is a unique chemokine that functions not only as a chemoattractant but also as an adhesion molecule and is expressed on endothelial cells activated by proinflammatory cytokines, such as interferon-gamma and tumor necrosis factor-alpha. Fractalkine/CX3CL1 is expressed in a membrane-bound form on activated endothelial cells and mediates attachment and firm adhesion of T cells, monocytes and NK cells. Fractalkine / CX3CL1 is associated with dendritic cells (DC) in epidermis and lymphoid organs. The fractalkine receptor, CX3CR1, is expressed on cytotoxic effector lymphocytes, including natural killer (NK) cells and cytotoxic T lymphocytes, which contain high levels of intracellular perforin and granzyme B, and on macrophages. Soluble fractalkine causes migration of NK cells, cytotoxic T lymphocytes, and macrophages, whereas the membrane-bound form captures and enhances the subsequent migration of these cells in response to secondary stimulation with other chemokines.

Ссылки
  • Imai T, et al. (1997) Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell. 91(4): 521-30.
  • Papadopoulos EJ, et al. (1999) Fractalkine, a CX3C chemokine, is expressed by dendritic cells and is up-regulated upon dendritic cell maturation. Eur J Immunol. 29 (8): 2551-9.
  • Umehara H, et al. (2004) Fractalkine in vascular biology: from basic research to clinical disease". Arterioscler. Thromb Vasc Biol. 24 (1): 34-40.
  • Size / Price
    Каталог: RG80163-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».