Быстрый заказ

Text Size:AAA

Крыса Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CTSS Информация о продукте «Клон cDNA»
Размер кДНК:957bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus cathepsin S with N terminal HA tag.
Синоним гена:CTSS
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80443-ACGRBS15400
Крыса Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80443-ACRRBS15400
Крыса Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80443-CFRBS13340
Крыса Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80443-CHRBS13340
Крыса Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80443-CMRBS13340
Крыса Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80443-CYRBS13340
Крыса Cathepsin S/CTSS Джин клон кДНК в вектор клонированияRG80443-GRBS5130
Крыса Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80443-NFRBS13340
Крыса Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80443-NHRBS13340
Крыса Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80443-NMRBS13340
Крыса Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80443-NYRBS13340
Крыса Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмидыRG80443-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Cathepsin S (CTSS), one of the lysosomal proteinases, has many important physiological functions in the nervous system, especially in process of extracellular matrix degradation and endocellular antigen presentation. CTSS is synthesized as inactive precursor of 331 amino acids consisting of a 15-aa signal peptide, a propeptide of 99 aa, and a mature polypeptide of 217 aa. It is activated in the lysosomes by a proteolytic cleavage of the propeptide. Cathepsin S is expressed in the lysosome of antigen presenting cells, primarily dendritic cells, B-cells and macrophages. Compared with other lysosomal cysteine proteases, cathepsin S has displayed some unique characteristics. Cathepsin S is most well known for its critical function in the proteolytic digestion of the invariant chain chaperone molecules, thus controlling antigen presentation to CD4+ T-cells by major histocompatibility complex (MHC) class II molecules or to NK1.1+ T-cells via CD1 molecules. Cathepsin S also appears to participate in direct processing of exogenous antigens for presentation by MHC class II to CD4+ T-cells, or in cross-presentation by MHC class I molecules to CD8+ T-cells. In addition, although direct evidence is still lacking, in its secreted form cathepsin S is implicated in degradation of the extracellular matrix, which may contribute to the pathology of a number of diseases, including arthritis, atherosclerosis, neurological diseases and chronic obstructive pulmonary disease.

  • Liu W, et al. (2004) Cysteine protease cathepsin S as a key step in antigen presentation. Drug News Perspect. 17(6): 357-63.
  • Thurmond RL, et al. (2005) Cathepsin S inhibitors as novel immunomodulators. Curr Opin Investig Drugs. 6(5): 473-82.
  • Wang DM, et al. (2008) Cathepsin S in pathogenesis of neurological diseases. Zhejiang Da Xue Xue Bao Yi Xue Ban. 37(4): 422-6.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.