After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса Cathepsin D/CTSD Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CTSD Информация о продукте «Клон cDNA»
Размер кДНК:1224bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus cathepsin D with N terminal Flag tag.
Синоним гена:Ctsd
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса Cathepsin D/CTSD Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса Cathepsin D/CTSD Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81328-ACGRBS15400
Крыса Cathepsin D/CTSD Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81328-ACRRBS15400
Крыса Cathepsin D/CTSD Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81328-CFRBS13340
Крыса Cathepsin D/CTSD Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81328-CHRBS13340
Крыса Cathepsin D/CTSD Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81328-CMRBS13340
Крыса Cathepsin D/CTSD Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81328-CYRBS13340
Крыса Cathepsin D/CTSD Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81328-NFRBS13340
Крыса Cathepsin D/CTSD Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81328-NHRBS13340
Крыса Cathepsin D/CTSD Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81328-NMRBS13340
Крыса Cathepsin D/CTSD Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81328-NYRBS13340
Крыса Cathepsin D/CTSD Джин клон кДНК в вектор клонированияRG81328-URBS5130
Крыса Cathepsin D/CTSD Джин ORF экспрессии кДНК клона плазмидыRG81328-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Cathepsin D (CTSD), a well known lysosomal aspartyl protease and belongs to the peptidase C1 family, which is a normal and major component of lysosomes, and is found in almost all cells and tissues of mammals. Its mostly described function is intracellular catabolism in lysosomal compartments, other physiological effect include hormone and antigen processing. Cathepsin D has a specificity similar to but narrower than that of pepsin A. Cathepsin D plays an important role in the degradation of proteins, the generation of bioactive proteins, antigen processing, etc. Among different role in cell physiology, a new function of this enzyme is examined. Cathepsin D is an important regulator of apoptotic pathways in cells. It acts at different stage of intrinsic and extrinsic pathway of apoptosis. In addition, CTSD secreted from human prostate carcinoma cells are responsible for the generation of angiostatin, a potent endogenous inhibitor of angiogenesis, suggesting its contribution to the prevention of tumor growth and angiogenesis-dependent growth of metastases.

  • Fusek M, et al. (2005) Dual role of cathepsin D: ligand and protease. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 149(1): 43-50.
  • Minarowska A, et al. (2007) Regulatory role of cathepsin D in apoptosis. Folia Histochem Cytobiol. 45(3): 159-63.
  • Zaidi N, et al. (2008) Cathepsin D: a cellular roadmap. Biochem Biophys Res Commun. 376(1): 5-9.
  • Size / Price
    Каталог: RG81328-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.