After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CTHRC1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001271300.1
Размер кДНК:693bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus collagen triple helix repeat containing 1 with N terminal Myc tag.
Синоним гена:Cthrc1
Виды:Rat
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80712-ACGRBS15400
Крыса CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80712-ACRRBS15400
Крыса CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80712-CFRBS13340
Крыса CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80712-CHRBS13340
Крыса CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80712-CMRBS13340
Крыса CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80712-CYRBS13340
Крыса CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80712-NFRBS13340
Крыса CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80712-NHRBS13340
Крыса CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80712-NMRBS13340
Крыса CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80712-NYRBS13340
Крыса CTHRC1 Джин клон кДНК в вектор клонированияRG80712-URBS5130
Крыса CTHRC1 Джин ORF экспрессии кДНК клона плазмидыRG80712-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Collagen triple helix repeat-containing protein 1, also known as Protein NMTC1, and CTHRC1, is a secreted protein that is glycosylated and highly conserved from lower chordates to mammals. CTHRC1 expression was not detectable in normal arteries. However, it is transiently expressed in the arterial wall in response to injury where it may contribute to vascular remodeling by limiting collagen matrix deposition and promoting cell migration. A short collagen motif with 12 Gly-X-Y repeats appears to be responsible for trimerization of the CTHRC1 protein and this renders the molecule susceptible to cleavage by collagenase. CTHRC1 overexpression caused a dramatic reduction in collagen type I mRNA and protein levels. Currently available data indicate that Cthrc1 expression in vascular cells regulates transforming growth factor beta responsiveness, thereby impacting transforming growth factor beta target genes, including collagens. Additionally, CTHRC1 increases bone mass as a positive regulator of osteoblastic bone formation and offers an anabolic approach for the treatment of osteoporosis.

Ссылки
  • Pyagay P, et al. (2005) Collagen triple helix repeat containing 1, a novel secreted protein in injured and diseased arteries, inhibits collagen expression and promotes cell migration. Circ Res. 96(2): 261-8.
  • Durmus T, et al. (2006) Expression analysis of the novel gene collagen triple helix repeat containing-1 (Cthrc1). Gene Expr Patterns. 6(8): 935-40.
  • LeClair R, et al. (2007) The role of collagen triple helix repeat containing 1 in injured arteries, collagen expression, and transforming growth factor beta signaling. Trends Cardiovasc Med. 17(6): 202-5.
  • Kimura H, et al. (2008) Cthrc1 is a positive regulator of osteoblastic bone formation. PLoS One. 3(9): e3174.
  • Size / Price
    Каталог: RG80712-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».