CD131 cDNA ORF Clone, Rat, C-HA tag

Price:
Size:
Number:

CD131 cDNA ORF Clone, Rat, C-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2691 bp
Description
Full length Clone DNA of Rat colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD131 Background Information

Colony stimulating factor 2 receptor, beta, low-affinity (CSF2RB) also known as CD131 antigen (CD131), cytokine receptor common subunit beta, GM-CSF/IL-3/IL-5 receptor common beta-chain, interleukin 3 receptor/granulocyte-macrophage colony stimulating factor 3 receptor, beta (IL3RB), is the common beta chain of the high affinity receptor for IL-3, IL-5 and CSF. Defects in this protein have been reported to be associated with protein alveolar proteinosis (PAP). CD131 belongs to the type I cytokine receptor family. The cluster of differentiation (cluster of designation) (often abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules present on white blood cells initially but found in almost any kind of cell of the body, providing targets for immunophenotyping of cells. Defects in CD131/CSF2RB are the cause of pulmonary surfactant metabolism dysfunction type 5 (SMDP5). SMDP5 is a rare lung disorder due to impaired surfactant homeostasis. It is characterized by alveolar filling with floccular material that stains positive using the periodic acid-Schiff method and is derived from surfactant phospholipids and protein components. Excessive lipoproteins accumulation in the alveoli results in severe respiratory distress.
Full Name
colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
References
  • Selleri S, et al. (2008) GM-CSF/IL-3/IL-5 receptor common beta chain (CD131) expression as a biomarker of antigen-stimulated CD8+ T cells. J Transl Med. 6:17.
  • Woodcock, et al. (1994) Three residues in the common beta chain of the human GM-CSF, IL-3 and IL-5 receptors are essential for GM-CSF and IL-5 but not IL-3 high affinity binding and interact with Glu21 of GM-CSF. EMBO J. 13(21): 5176-85.
  • Dirksen U, et al. (1997) Human pulmonary alveolar proteinosis associated with a defect in GM-CSF/IL-3/IL-5 receptor common beta chain expression. J Clin Invest. 100(9): 2211-7.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait