After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса CD131/CSF2RB/IL3RB/IL5RB Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CSF2RB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_133555.1
Размер кДНК:2691bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) with N terminal His tag.
Синоним гена:Csf2rb1, Csf2rb
Виды:Rat
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса CD131/CSF2RB/IL3RB/IL5RB Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса CD131/CSF2RB/IL3RB/IL5RB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80323-ACGRBS22240
Крыса CD131/CSF2RB/IL3RB/IL5RB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80323-ACRRBS22240
Крыса CD131/CSF2RB/IL3RB/IL5RB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80323-CFRBS20190
Крыса CD131/CSF2RB/IL3RB/IL5RB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80323-CHRBS20190
Крыса CD131/CSF2RB/IL3RB/IL5RB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80323-CMRBS20190
Крыса CD131/CSF2RB/IL3RB/IL5RB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80323-CYRBS20190
Крыса CD131/CSF2RB/IL3RB/IL5RB Джин клон кДНК в вектор клонированияRG80323-GRBS5130
Крыса CD131/CSF2RB/IL3RB/IL5RB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80323-NFRBS20190
Крыса CD131/CSF2RB/IL3RB/IL5RB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80323-NHRBS20190
Крыса CD131/CSF2RB/IL3RB/IL5RB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80323-NMRBS20190
Крыса CD131/CSF2RB/IL3RB/IL5RB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80323-NYRBS20190
Крыса CD131/CSF2RB/IL3RB/IL5RB Джин ORF экспрессии кДНК клона плазмидыRG80323-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Colony stimulating factor 2 receptor, beta, low-affinity (CSF2RB) also known as CD131 antigen (CD131), cytokine receptor common subunit beta, GM-CSF/IL-3/IL-5 receptor common beta-chain, interleukin 3 receptor/granulocyte-macrophage colony stimulating factor 3 receptor, beta (IL3RB), is the common beta chain of the high affinity receptor for IL-3, IL-5 and CSF. Defects in this protein have been reported to be associated with protein alveolar proteinosis (PAP). CD131 belongs to the type I cytokine receptor family. The cluster of differentiation (cluster of designation) (often abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules present on white blood cells initially but found in almost any kind of cell of the body, providing targets for immunophenotyping of cells. Defects in CD131/CSF2RB are the cause of pulmonary surfactant metabolism dysfunction type 5 (SMDP5). SMDP5 is a rare lung disorder due to impaired surfactant homeostasis. It is characterized by alveolar filling with floccular material that stains positive using the periodic acid-Schiff method and is derived from surfactant phospholipids and protein components. Excessive lipoproteins accumulation in the alveoli results in severe respiratory distress.

Ссылки
  • Selleri S, et al. (2008) GM-CSF/IL-3/IL-5 receptor common beta chain (CD131) expression as a biomarker of antigen-stimulated CD8+ T cells. J Transl Med. 6:17.
  • Woodcock, et al. (1994) Three residues in the common beta chain of the human GM-CSF, IL-3 and IL-5 receptors are essential for GM-CSF and IL-5 but not IL-3 high affinity binding and interact with Glu21 of GM-CSF. EMBO J. 13(21): 5176-85.
  • Dirksen U, et al. (1997) Human pulmonary alveolar proteinosis associated with a defect in GM-CSF/IL-3/IL-5 receptor common beta chain expression. J Clin Invest. 100(9): 2211-7.
  • Size / Price
    Каталог: RG80323-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».