Быстрый заказ

Крыса CRISP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CRISP2 Информация о продукте «Клон cDNA»
Размер кДНК:732bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus cysteine-rich secretory protein 2 with N terminal HA tag.
Синоним гена:Tpx1, Crisp2l
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса CRISP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса CRISP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80444-ACGRBS15396
Крыса CRISP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80444-ACRRBS15400
Крыса CRISP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80444-CFRBS13343
Крыса CRISP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80444-CHRBS13343
Крыса CRISP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80444-CMRBS13343
Крыса CRISP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80444-CYRBS13343
Крыса CRISP2 Джин клон кДНК в вектор клонированияRG80444-GRBS5132
Крыса CRISP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80444-NFRBS13343
Крыса CRISP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80444-NHRBS13343
Крыса CRISP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80444-NMRBS13343
Крыса CRISP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80444-NYRBS13343
Крыса CRISP2 Джин ORF экспрессии кДНК клона плазмидыRG80444-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80444-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.