After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса CPXM Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CPXM1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001106511.1
Размер кДНК:2169bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus carboxypeptidase X (M14 family), member 1.
Синоним гена:Cpxm1
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса CPXM Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса CPXM Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81044-ACGRBS16760
Крыса CPXM Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81044-ACRRBS16760
Крыса CPXM Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81044-CFRBS14710
Крыса CPXM Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81044-CHRBS14710
Крыса CPXM Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81044-CMRBS14710
Крыса CPXM Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81044-CYRBS14710
Крыса CPXM Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81044-NFRBS14710
Крыса CPXM Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81044-NHRBS14710
Крыса CPXM Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81044-NMRBS14710
Крыса CPXM Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81044-NYRBS14710
Крыса CPXM Джин клон кДНК в вектор клонированияRG81044-URBS5130
Крыса CPXM Джин ORF экспрессии кДНК клона плазмидыRG81044-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81044-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».