After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса COQ7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat COQ7 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_012785.3
Размер кДНК:654bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus coenzyme Q7 homolog, ubiquinone (yeast) with N terminal Myc tag.
Синоним гена:Coq7
Виды:Rat
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса COQ7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса COQ7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80718-ACGRBS15400
Крыса COQ7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80718-ACRRBS15400
Крыса COQ7 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80718-ANGRBS15400
Крыса COQ7 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80718-ANRRBS15400
Крыса COQ7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80718-CFRBS13340
Крыса COQ7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80718-CHRBS13340
Крыса COQ7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80718-CMRBS13340
Крыса COQ7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80718-CYRBS13340
Крыса COQ7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80718-NFRBS13340
Крыса COQ7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80718-NHRBS13340
Крыса COQ7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80718-NMRBS13340
Крыса COQ7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80718-NYRBS13340
Крыса COQ7 Джин клон кДНК в вектор клонированияRG80718-URBS5130
Крыса COQ7 Джин ORF экспрессии кДНК клона плазмидыRG80718-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Ubiquinone biosynthesis protein COQ7 homolog, also known as Coenzyme Q biosynthesis protein 7 homolog, Timing protein clk-1 homolog and COQ7, is a mitochondrion inner membrane and peripheral membrane protein which belongs to the COQ7 family. It is expressed dominantly in heart and skeletal muscle. COQ7 is synthesized as a preprotein that is imported into the mitochondrial matrix, where the sequence is cleaved off and the mature protein becomes loosely associated with the inner membrane. This enzyme is responsible for the hydroxylation of 5-demethoxyubiquinone to 5-hydroxyubiquinone. Human COQ7 protein is mostly helical, and contains an alpha-helical membrane insertion. It has a potential N-glycosylation site, a phosphorylation site for protein kinase C and another for casein kinase II, and three N-myristoylation sites. COQ7 is involved in lifespan determination in ubiquinone-independent manner. It is also involved in ubiquinone biosynthesis. COQ7 is potential central metabolic regulator.

Ссылки
  • Ewbank J.J., et al., 1997, Science. 275: 980-3.
  • Vajo Z., et al., 1999, Mamm. Genome. 10: 1000-4.
  • Wiemann S., et al., 2001, Genome Res. 11: 422-35.
  • Stenmark,P. et al., 2001, J Biol Chem. 276 (36): 33297-300.
  • Martin J., et al., 2004, Nature. 432: 988-94. 
  • Size / Price
    Каталог: RG80718-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».