Быстрый заказ

Крыса Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CNTN3 Информация о продукте «Клон cDNA»
Размер кДНК:3087bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus contactin 3 (plasmacytoma associated) with N terminal His tag.
Синоним гена:Pang, BIG-1, Cntn3
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80316-ACGRBS22240
Крыса Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80316-ACRRBS22240
Крыса Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80316-CFRBS20190
Крыса Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80316-CHRBS20190
Крыса Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80316-CMRBS20190
Крыса Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80316-CYRBS20190
Крыса Contactin 3/CNTN3 Джин клон кДНК в вектор клонированияRG80316-GRBS5130
Крыса Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80316-NFRBS20190
Крыса Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80316-NHRBS20190
Крыса Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80316-NMRBS20190
Крыса Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80316-NYRBS20190
Крыса Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмидыRG80316-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2(TAG-1), Contactin-3(BIG-1), BIG-2, Contactin-5(NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-3, also known as CNTN3 ( BIG-1 in rat and PANG in mouse ), is a GPI-linked glycoprotein that is expressed on cerebellar Purkinje cells, amygdaloid and thalamic neurons and olfactory granule cells. In the brain, Contactin-3 is expressed in frontal lobe, occipital lobe, cerebellum and amygdala. Contactin-3 contains 4 fibronectin type-III domains and 6 Ig-like C2-type (immunoglobulin-like) domains. Human Contactin-3 shares 92% aa identity with mouse Contactin-3.The exact function of Contactin-3 is unclear. Contactin-3 may mediate cell-cell interaction and may promote neurite outgrowth.

  • Yoshihara Y, et al. (1994) BIG-1: a new TAG-1/F3-related member of the immunoglobulin superfamily with neurite outgrowth-promoting activity. Neuron 13(2):415-26.
  • Yoshihara Y, et al. (1995) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. Journal of neurobiology 28(1):51-69.
  • Yoshihara Y, et al. (1995) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. Journal of neurobiology 28(1):51-69.
  • Shimoda Y, et al. (2009) Contactins: Emerging key roles in the development and function of the nervous system. Cell adhesion & migration 3(1):64-70.
  • Size / Price
    Каталог: RG80316-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.