TAG1 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80420-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All TAG1 Reagents

CRO Services

Product recommended


All TAG1 Reagents

TAG1 cDNA ORF Clone, Rat, N-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3123 bp
Description
Full length Clone DNA of Rat contactin 2 (axonal) with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TAG1 Background Information

Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2(TAG-1), Contactin-3(BIG-1), BIG-2, Contactin-5(NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-2, also known as CNTN2, is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. The human, rat, and chicken Contactin-2 are alternatively known as TAX1 (transiently-expressed axonal glycoprotein), TAG1 (transient axonal glycoprotein), and axonin-1, respectively. Human Contactin-2 shares approximately 91% and 75% amino acid sequence identity with rat and chicken Contactin-2, respectively. Contactin-2 is expressed by a subset of neuronal populations in the developing central nervous system (CNS) and peripheral nervous system (PNS). Contactin-2 is also expressed by oligodendrocytes and Schwann cells, which are myelinating glial cells of the CNS and PNS, respectively. Contactin-2 may play a role in the formation of axon connections in the developing nervous system. Contactin-2 is also involved in glial tumorigenesis and may provide a potential target for therapeutic intervention. During embryonic development, Contactin-2 interacts either in a homophilic, or heterophilic fashion with various transmembrane proteins.

Full Name
contactin 2 (axonal)
References
  • Kyriakopoulou K, et al. (2002) A combination of chain and neurophilic migration involving the adhesion molecule TAG-1 in the caudal medulla. Development 129 (2):287-96.
  • Traka M, et al. (2002) The neuronal adhesion protein TAG-1 is expressed by Schwann cells and oligodendrocytes and is localized to the juxtaparanodal region of myelinated fibers. J Neurosci. 22(8):3016-24.
  • Traka M, et al. (2003) Association of TAG-1 with Caspr2 is essential for the molecular organization of juxtaparanodal regions of myelinated fibers. J Cell Biol. 162(6):1161-72.
  • Soares S, et al. (2005) Neuronal and glial expression of the adhesion molecule TAG-1 is regulated after peripheral nerve lesion or central neurodegeneration of adult nervous system. Eur J Neurosci. 21(5):1169-80.
  • Derfuss T, et al. (2009) Contactin-2/TAG-1-directed autoimmunity is identified in multiple sclerosis patients and mediates gray matter pathology in animals. Proc Natl Acad Sci U S A. 106(20):8302-7.
  • TAG1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TAG1 cDNA ORF Clone in Cloning Vector, Rat RG80420-G
    TAG1 cDNA ORF Clone, Rat, untagged RG80420-UT
    TAG1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80420-ACGLN
    TAG1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80420-ACG
    TAG1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80420-ACR
    TAG1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80420-CF
    TAG1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80420-NF
    TAG1 cDNA ORF Clone, Rat, C-His tag RG80420-CH
    TAG1 cDNA ORF Clone, Rat, N-His tag RG80420-NH
    TAG1 cDNA ORF Clone, Rat, C-HA tag RG80420-CY
    TAG1 cDNA ORF Clone, Rat, N-HA tag RG80420-NY
    TAG1 cDNA ORF Clone, Rat, C-Myc tag RG80420-CM
    TAG1 qPCR Primer Pairs, Rat RP300384

    TAG1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TAG1 cDNA ORF Clone in Cloning Vector, Human HG10457-M
    TAG1 cDNA ORF Clone, Human, untagged HG10457-UT
    TAG1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10457-ACG
    TAG1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10457-ACGLN
    TAG1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10457-ACR
    TAG1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10457-CF
    TAG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10457-NF
    TAG1 cDNA ORF Clone, Human, C-His tag HG10457-CH
    TAG1 cDNA ORF Clone, Human, N-His tag HG10457-NH
    TAG1 cDNA ORF Clone, Human, C-HA tag HG10457-CY
    TAG1 cDNA ORF Clone, Human, N-HA tag HG10457-NY
    TAG1 cDNA ORF Clone, Human, C-Myc tag HG10457-CM
    TAG1 cDNA ORF Clone, Human, N-Myc tag HG10457-NM
    TAG1 qPCR Primer Pairs, Human HP100485

    TAG1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TAG1 qPCR Primer Pairs, Mouse MP201063
    info info
    添加购物车成功! 添加购物车失败!