TAG1 cDNA ORF Clone, Rat, N-Myc tag

Price:
Size:
Number:

TAG1 cDNA ORF Clone, Rat, N-Myc tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3123 bp
Description
Full length Clone DNA of Rat contactin 2 (axonal) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TAG1 Background Information

Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2(TAG-1), Contactin-3(BIG-1), BIG-2, Contactin-5(NB-2) and NB-3. Since their identification in the late 198s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-2, also known as CNTN2, is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. The human, rat, and chicken Contactin-2 are alternatively known as TAX1 (transiently-expressed axonal glycoprotein), TAG1 (transient axonal glycoprotein), and axonin-1, respectively. Human Contactin-2 shares approximately 91% and 75% amino acid sequence identity with rat and chicken Contactin-2, respectively. Contactin-2 is expressed by a subset of neuronal populations in the developing central nervous system (CNS) and peripheral nervous system (PNS). Contactin-2 is also expressed by oligodendrocytes and Schwann cells, which are myelinating glial cells of the CNS and PNS, respectively. Contactin-2 may play a role in the formation of axon connections in the developing nervous system. Contactin-2 is also involved in glial tumorigenesis and may provide a potential target for therapeutic intervention. During embryonic development, Contactin-2 interacts either in a homophilic, or heterophilic fashion with various transmembrane proteins.
Full Name
contactin 2 (axonal)
References
  • Kyriakopoulou K, et al. (2002) A combination of chain and neurophilic migration involving the adhesion molecule TAG-1 in the caudal medulla. Development 129 (2):287-96.
  • Traka M, et al. (2002) The neuronal adhesion protein TAG-1 is expressed by Schwann cells and oligodendrocytes and is localized to the juxtaparanodal region of myelinated fibers. J Neurosci. 22(8):3016-24.
  • Traka M, et al. (2003) Association of TAG-1 with Caspr2 is essential for the molecular organization of juxtaparanodal regions of myelinated fibers. J Cell Biol. 162(6):1161-72.
  • Soares S, et al. (2005) Neuronal and glial expression of the adhesion molecule TAG-1 is regulated after peripheral nerve lesion or central neurodegeneration of adult nervous system. Eur J Neurosci. 21(5):1169-80.
  • Derfuss T, et al. (2009) Contactin-2/TAG-1-directed autoimmunity is identified in multiple sclerosis patients and mediates gray matter pathology in animals. Proc Natl Acad Sci U S A. 106(20):8302-7.

TAG1 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed