After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса Contactin 1/CNTN1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CNTN1 Информация о продукте «Клон cDNA»
Размер кДНК:3066bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus contactin 1 with N terminal His tag.
Синоним гена:F3, Cntn1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса Contactin 1/CNTN1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса Contactin 1/CNTN1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80315-ACGRBS22240
Крыса Contactin 1/CNTN1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80315-ACRRBS22240
Крыса Contactin 1/CNTN1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80315-CFRBS20190
Крыса Contactin 1/CNTN1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80315-CHRBS20190
Крыса Contactin 1/CNTN1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80315-CMRBS20190
Крыса Contactin 1/CNTN1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80315-CYRBS20190
Крыса Contactin 1/CNTN1 Джин клон кДНК в вектор клонированияRG80315-GRBS5130
Крыса Contactin 1/CNTN1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80315-NFRBS20190
Крыса Contactin 1/CNTN1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80315-NHRBS20190
Крыса Contactin 1/CNTN1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80315-NMRBS20190
Крыса Contactin 1/CNTN1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80315-NYRBS20190
Крыса Contactin 1/CNTN1 Джин ORF экспрессии кДНК клона плазмидыRG80315-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2 (TAG-1), Contactin-3 (BIG-1), BIG-2, Contactin-5 (NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-1 is a cell surface adhesion molecule that is normally expressed by neurons and oligodendrocytes. Particularly high levels of Contactin-1 are present during brain development. Contactin-1 and Contactin-2 are differentially expressed in a number of neuronal tissues during development, and they interact with several ligands including Nr-CAM, L1, NCAM, neurocan, phosphacan, and tenascin. As a cell adhesion molecule, Contactin-1 plays a role in the formation of axon connections in the developing nervous system. It was demonstrated that Contactin-1 participates in signal pathways via its association with Contactin-associated protein (CNTNAP1), receptor protein tyrosine phosphatase beta (RPTPb) and NOTCH1. Contactin-1 is also involved in paranodal axo-glial junction formation and oligodendrocytes generation. Furthermore, studies indicated that Contactin-1 functions importantly in the invasion and metastasis of lung adenocarcinoma cells. Contactin-1 may also significantly influence the functional expression and distribution of Na+ channels in neurons.

  • Kazarinova NK, et al. (2001) Contactin associates with Na+ channels and increases their functional expression. J Neurosci. 21 (19):7517-25.
  • Eckerich C, et al. (2006) Contactin is expressed in human astrocytic gliomas and mediates repulsive effects. Glia. 53(1):1-12.
  • Su JL, et al. (2006) Knockdown of contactin-1 expression suppresses invasion and metastasis of lung adenocarcinoma. Cancer research 66 (5):2553-61.
  • Compton AG, et al. (2008) Mutations in contactin-1, a neural adhesion and neuromuscular junction protein, cause a familial form of lethal congenital myopathy. Am J Hum Genet. 83 (6):714-24.
  • Mikami T, et al. (2009) Contactin-1 is a functional receptor for neuroregulatory chondroitin sulfate-E. J Biol Chem. 284(7):4494-9.
  • Size / Price
    Каталог: RG80315-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.