Быстрый заказ

Крыса Acidic Calponin/CNN3 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Крыса CNN3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_019359.1
Размер кДНК:993bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus calponin 3, acidic.
Синоним гена:Cnn3
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CNN3 qPCR primers for gene expression analysis, RP300977 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса Acidic Calponin/CNN3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса Acidic Calponin/CNN3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81013-ACGRBS15400
Крыса Acidic Calponin/CNN3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81013-ACRRBS15400
Крыса Acidic Calponin/CNN3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81013-ANGRBS15400
Крыса Acidic Calponin/CNN3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81013-ANRRBS15400
Крыса Acidic Calponin/CNN3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81013-CFRBS13340
Крыса Acidic Calponin/CNN3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81013-CHRBS13340
Крыса Acidic Calponin/CNN3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81013-CMRBS13340
Крыса Acidic Calponin/CNN3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81013-CYRBS13340
Крыса Acidic Calponin/CNN3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81013-NFRBS13340
Крыса Acidic Calponin/CNN3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81013-NHRBS13340
Крыса Acidic Calponin/CNN3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81013-NMRBS13340
Крыса Acidic Calponin/CNN3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81013-NYRBS13340
Крыса Acidic Calponin/CNN3 Джин клон кДНК в вектор клонированияRG81013-URBS5130
Крыса Acidic Calponin/CNN3 Джин ORF экспрессии кДНК клона плазмидыRG81013-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81013-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».