Быстрый заказ

Крыса Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса CLU Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC061534.1
    Размер кДНК:1344bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus clusterin with N terminal Flag tag.
    Синоним гена:APOJ,CLI,DAG,RATTRPM2B,SGP-2,SGP2,SP-40,SP40,TRPM-2,Trpm2,TRPM2B,Trpmb
    Виды:Rat
    переносчик:pCMV3-SP-N-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Крыса Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
    Крыса Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81601-ACGRBS15400
    Крыса Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81601-ACRRBS15400
    Крыса Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81601-CFRBS13340
    Крыса Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81601-CHRBS13340
    Крыса Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81601-CMRBS13340
    Крыса Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81601-CYRBS13340
    Крыса Clusterin/Apolipoprotein J/Apo-J Джин клон кДНК в вектор клонированияRG81601-GRBS5130
    Крыса Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81601-NFRBS13340
    Крыса Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81601-NHRBS13340
    Крыса Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81601-NMRBS13340
    Крыса Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81601-NYRBS13340
    Крыса Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмидыRG81601-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Clusterin, also known as complement-associated protein SP-40, Complement cytolysis inhibitor, Apolipoprotein J, Testosterone-repressed prostate message 2, Aging-associated gene 4 protein, CLU and APOJ, is a secreted protein which belongs to the clusterin family. Clusterin/Apolipoprotein J/Apo-J is an enigmatic glycoprotein with a nearly ubiquitous tissue distribution and an apparent involvement in biological processes ranging from mammary gland involution to neurodegeneration in Alzheimer's disease. Its major form, a heterodimer, is secreted and present in physiological fluids, but truncated forms targeted to the nucleus have also been identified. Clusterin/Apolipoprotein J/Apo-J is a widely distributed glycoprotein with a wide range of biologic properties. A prominent and defining feature of clusterin is its marked induction in such disease states as glomerulonephritis, cystic renal disease, renal tubular injury, neurodegenerative conditions, atherosclerosis, and myocardial infarction. Upregulation of clusterin mRNA and protein levels detected in diverse disease states and in in vitro systems have led to suggestions that it functions in membrane lipid recycling, in apoptotic cell death, and as a stress-induced secreted chaperone protein, amongst others.

    Ссылки
  • Silkensen JR, et al. (1994) The role of clusterin in tissue injury. Biochem Cell Biol. 72(11-12): 483-8.
  • Naik RR, et al. (2002) Biomimetic synthesis and patterning of silver nanoparticles. Nat Mater. 1(3): 169-72.
  • Djeu JY, et al. (2009) Clusterin and chemoresistance. Adv Cancer Res. 105: 77-92.
  • Size / Price
    Каталог: RG81601-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».