After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса CLPS / Colipase Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CLPS Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_013139.1
Размер кДНК:339bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus colipase, pancreatic with N terminal Myc tag.
Синоним гена:COLQ
Виды:Rat
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса CLPS / Colipase Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса CLPS / Colipase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80729-ACGRBS15400
Крыса CLPS / Colipase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80729-ACRRBS15400
Крыса CLPS / Colipase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80729-CFRBS13340
Крыса CLPS / Colipase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80729-CHRBS13340
Крыса CLPS / Colipase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80729-CMRBS13340
Крыса CLPS / Colipase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80729-CYRBS13340
Крыса CLPS / Colipase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80729-NFRBS13340
Крыса CLPS / Colipase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80729-NHRBS13340
Крыса CLPS / Colipase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80729-NMRBS13340
Крыса CLPS / Colipase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80729-NYRBS13340
Крыса CLPS / Colipase Джин клон кДНК в вектор клонированияRG80729-URBS5130
Крыса CLPS / Colipase Джин ORF экспрессии кДНК клона плазмидыRG80729-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Colipase belongs to the colipase family. Structural studies of the complex and of colipase alone have revealed the functionality of its architecture. It is a small protein with five conserved disulphide bonds. Structural analogies have been recognised between a developmental protein, the pancreatic lipase C-terminal domain, the N-terminal domains of lipoxygenases and the C-terminal domain of alpha-toxin. Colipase can only be detected in pancreatic acinar cells, suggesting regulation of expression by tissue-specific elements. Colipase allows lipase to anchor noncovalently to the surface of lipid micelles, counteracting the destabilizing influence of intestinal bile salts. Without colipase the enzyme is washed off by bile salts, which have an inhibitory effect on the lipase. Colipase is a cofactor needed by pancreatic lipase for efficient dietary lipid hydrolysis. It binds to the C-terminal, non-catalytic domain of lipase, thereby stabilising as active conformation and considerably increasing the overall hydrophobic binding site.

Ссылки
  • Davis RC, et al. (1991) Assignment of the human pancreatic colipase gene to chromosome 6p21.1 to pter. Genomics. 10(1):262-5.
  • Lowe ME. (1997) Structure and function of pancreatic lipase and colipase. Annu Rev Nutr. 17: 141-58.
  • Verger R, et al. (1999) Colipase: structure and interaction with pancreatic lipase. Biochim Biophys Acta. 1441(2-3):173-84.
  • Size / Price
    Каталог: RG80729-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».