Быстрый заказ

Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса CLEC5A Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001109377.1
    Размер кДНК:573bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 5, member A.
    Синоним гена:Clec5a
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CLEC5A qPCR primers for gene expression analysis, RP300244 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80259-ACGRBS15400
    Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80259-ACRRBS15400
    Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80259-CFRBS13340
    Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80259-CHRBS13340
    Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80259-CMRBS13340
    Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80259-CYRBS13340
    Крыса CLEC5A / MDL1 / MDL-1 Джин клон кДНК в вектор клонированияRG80259-GRBS5130
    Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80259-NFRBS13340
    Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80259-NHRBS13340
    Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80259-NMRBS13340
    Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80259-NYRBS13340
    Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмидыRG80259-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    CLEC5A, also known as MDL1 and MDL-1, is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. CLEC5A with dnax-activation protein 12 and may play a role in cell activation. It also functions as a positive regulator of osteoclastogenesis. CLEC5A acts as a key regulator of synovial injury and bone erosion during autoimmune joint inflammation .The binding of dengue virus to CLEC5A triggers signaling through the phosphylation of TYROBP, this interaction does not result in viral entry, but stimulates proinflammatory cytokine release.

    Ссылки
  • Chen ST. et al., 2008, Nature. 453 (7195): 672-6.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Hillier LW. et al., 2003, Nature. 424 (6945): 157-64.
  • Size / Price
    Каталог: RG80259-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».