Быстрый заказ

Text Size:AAA

Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CLEC5A Информация о продукте «Клон cDNA»
Размер кДНК:573bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 5, member A with C terminal His tag.
Синоним гена:Clec5a
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80259-ACGRBS15400
Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80259-ACRRBS15400
Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80259-CFRBS13340
Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80259-CHRBS13340
Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80259-CMRBS13340
Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80259-CYRBS13340
Крыса CLEC5A / MDL1 / MDL-1 Джин клон кДНК в вектор клонированияRG80259-GRBS5130
Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80259-NFRBS13340
Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80259-NHRBS13340
Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80259-NMRBS13340
Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80259-NYRBS13340
Крыса CLEC5A / MDL1 / MDL-1 Джин ORF экспрессии кДНК клона плазмидыRG80259-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CLEC5A, also known as MDL1 and MDL-1, is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. CLEC5A with dnax-activation protein 12 and may play a role in cell activation. It also functions as a positive regulator of osteoclastogenesis. CLEC5A acts as a key regulator of synovial injury and bone erosion during autoimmune joint inflammation .The binding of dengue virus to CLEC5A triggers signaling through the phosphylation of TYROBP, this interaction does not result in viral entry, but stimulates proinflammatory cytokine release.

  • Chen ST. et al., 2008, Nature. 453 (7195): 672-6.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Hillier LW. et al., 2003, Nature. 424 (6945): 157-64.
  • Size / Price
    Каталог: RG80259-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.