Быстрый заказ

Text Size:AAA

Крыса CLEC4B2 / mDCAR1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CLEC4B2 Информация о продукте «Клон cDNA»
Размер кДНК:627bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 4, member B2 with C terminal His tag.
Синоним гена:Aplra1, Clec4b2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса CLEC4B2 / mDCAR1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса CLEC4B2 / mDCAR1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80265-ACGRBS15400
Крыса CLEC4B2 / mDCAR1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80265-ACRRBS15400
Крыса CLEC4B2 / mDCAR1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80265-ANGRBS15400
Крыса CLEC4B2 / mDCAR1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80265-ANRRBS15400
Крыса CLEC4B2 / mDCAR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80265-CFRBS13340
Крыса CLEC4B2 / mDCAR1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80265-CHRBS13340
Крыса CLEC4B2 / mDCAR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80265-CMRBS13340
Крыса CLEC4B2 / mDCAR1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80265-CYRBS13340
Крыса CLEC4B2 / mDCAR1 Джин клон кДНК в вектор клонированияRG80265-GRBS5130
Крыса CLEC4B2 / mDCAR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80265-NFRBS13340
Крыса CLEC4B2 / mDCAR1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80265-NHRBS13340
Крыса CLEC4B2 / mDCAR1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80265-NMRBS13340
Крыса CLEC4B2 / mDCAR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80265-NYRBS13340
Крыса CLEC4B2 / mDCAR1 Джин ORF экспрессии кДНК клона плазмидыRG80265-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Clec4b2, also known as mDCAR1, is a member of the DCIR/DCAR family. Expression of Clec4b2 was strongly tissue dependent. Clec4b2 expression on DCs was restricted to the CD8(+) DC subset in spleen and thymus and on subpopulations of CD11b(+) myeloid cells in bone marrow and spleen, whereas the molecule was not detectable on both cell types in lymph nodes and peripheral blood. Clec4b2 is a functional receptor on cells of the immune system and provides further insights into the regulation of immune responses by CLRs.

  • Katayama S. et al., 2005, Science. 309 (5740): 1564-6.
  • Kaden SA. et al., 2009, J Immunol. 183 (8): 5069-78.
  • Skarnes WC. et al., 2011, Nature. 474 (7351): 337-42.
  • Size / Price
    Каталог: RG80265-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.