CLEC2D cDNA ORF Clone, Rat, C-His tag

Cat: RG80260-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CLEC2D Reagents

CRO Services

Product recommended


All CLEC2D Reagents

CLEC2D cDNA ORF Clone, Rat, C-His tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
702 bp
Description
Full length Clone DNA of Rat C-type lectin domain family 2, member D with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLEC2D Background Information

Lectin-like transcript 1 (LLT1) encoded by CLEC2D gene is a C-type lectin-like molecule interacting with human CD161 (NKR-P1A) receptor expressed by natural killer cells and subsets of T cells. CLEC2D transcripts were detected primarily in hematopoietic cell lines and were found to be co-induced by the same activation signals. Although very low amounts of putative soluble CLEC2D protein isoforms could be produced by transfectants, CLEC2D isoforms 2 and 4 were efficiently expressed. CLEC2D uses gene splicing to generate protein isoforms that are structurally distinct and that have different biological activities. Prostate cancer is the most common type of cancer diagnosed and the second leading cause of cancer-related death in American men. Natural Killer (NK) cells are the first line of defense against cancer and infections. NK cell function is regulated by a delicate balance between signals received through activating and inhibitory receptors. Previously, we identified Lectin-like transcript-1 (LLT1/OCIL/CLEC2D) as a counter-receptor for the NK cell inhibitory receptor NKRP1A (CD161). Interaction of LLT1 expressed on target cells with NKRP1A inhibits NK cell activation.
Full Name
C-type lectin domain family 2, member D

CLEC2D cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CLEC2D cDNA ORF Clone in Cloning Vector, Rat RG80260-G
CLEC2D cDNA ORF Clone, Rat, untagged RG80260-UT
CLEC2D Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80260-ACGLN
CLEC2D cDNA ORF Clone, Rat, C-GFPSpark® tag RG80260-ACG
CLEC2D cDNA ORF Clone, Rat, C-OFPSpark® tag RG80260-ACR
CLEC2D cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80260-CF
CLEC2D cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80260-NF
CLEC2D cDNA ORF Clone, Rat, N-His tag RG80260-NH
CLEC2D cDNA ORF Clone, Rat, C-HA tag RG80260-CY
CLEC2D cDNA ORF Clone, Rat, N-HA tag RG80260-NY
CLEC2D cDNA ORF Clone, Rat, C-Myc tag RG80260-CM
CLEC2D cDNA ORF Clone, Rat, N-Myc tag RG80260-NM
CLEC2D qPCR Primer Pairs, Rat RP300245

CLEC2D cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CLEC2D cDNA ORF Clone in Cloning Vector, Human HG29742-U
CLEC2D cDNA ORF Clone in Cloning Vector, Human HG11651-M
CLEC2D cDNA ORF Clone, Human, untagged HG11651-UT
CLEC2D cDNA ORF Clone, Human, C-GFPSpark® tag HG11651-ACG
CLEC2D Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11651-ACGLN
CLEC2D cDNA ORF Clone, Human, C-OFPSpark® tag HG11651-ACR
CLEC2D cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11651-CF
CLEC2D cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11651-NF
CLEC2D cDNA ORF Clone, Human, C-His tag HG11651-CH
CLEC2D cDNA ORF Clone, Human, N-His tag HG11651-NH
CLEC2D cDNA ORF Clone, Human, C-HA tag HG11651-CY
CLEC2D cDNA ORF Clone, Human, N-HA tag HG11651-NY
CLEC2D cDNA ORF Clone, Human, C-Myc tag HG11651-CM
CLEC2D cDNA ORF Clone, Human, N-Myc tag HG11651-NM
CLEC2D qPCR Primer Pairs, Human HP101497
info info
添加购物车成功! 添加购物车失败!