Быстрый заказ

Text Size:AAA

Крыса CLEC2D / OCIL Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CLEC2D Информация о продукте «Клон cDNA»
Размер кДНК:702bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 2, member D with C terminal His tag.
Синоним гена:Ocil, Clec2d5, Clec2d
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса CLEC2D / OCIL Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса CLEC2D / OCIL Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80260-ACGRBS15400
Крыса CLEC2D / OCIL Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80260-ACRRBS15400
Крыса CLEC2D / OCIL Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80260-CFRBS13343
Крыса CLEC2D / OCIL Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80260-CHRBS13343
Крыса CLEC2D / OCIL Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80260-CMRBS13343
Крыса CLEC2D / OCIL Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80260-CYRBS13343
Крыса CLEC2D / OCIL Джин клон кДНК в вектор клонированияRG80260-GRBS5130
Крыса CLEC2D / OCIL Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80260-NFRBS13343
Крыса CLEC2D / OCIL Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80260-NHRBS13343
Крыса CLEC2D / OCIL Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80260-NMRBS13340
Крыса CLEC2D / OCIL Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80260-NYRBS13343
Крыса CLEC2D / OCIL Джин ORF экспрессии кДНК клона плазмидыRG80260-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80260-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.