Быстрый заказ

Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса CLEC11A Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001012459.1
    Размер кДНК:987bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 11, member A.
    Синоним гена:Scgf, Clec11a
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CLEC11A qPCR primers for gene expression analysis, RP300239 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80254-ACGRBS15400
    Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80254-ACRRBS15400
    Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80254-CFRBS13340
    Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80254-CHRBS13340
    Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80254-CMRBS13340
    Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80254-CYRBS13340
    Крыса SCGF/CLEC11A Джин клон кДНК в вектор клонированияRG80254-GRBS5130
    Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80254-NFRBS13340
    Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80254-NHRBS13340
    Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80254-NMRBS13340
    Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80254-NYRBS13340
    Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмидыRG80254-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».