After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CLEC11A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001012459.1
Размер кДНК:987bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 11, member A.
Синоним гена:Scgf, Clec11a
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80254-ACGRBS15400
Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80254-ACRRBS15400
Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80254-CFRBS13340
Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80254-CHRBS13340
Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80254-CMRBS13340
Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80254-CYRBS13340
Крыса SCGF/CLEC11A Джин клон кДНК в вектор клонированияRG80254-GRBS5130
Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80254-NFRBS13340
Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80254-NHRBS13340
Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80254-NMRBS13340
Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80254-NYRBS13340
Крыса SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмидыRG80254-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80254-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».