After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CDH5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001107407.1
Размер кДНК:2331bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus cadherin 5 with C terminal His tag.
Синоним гена:Cdh5
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80276-ACGRBS16760
Крыса VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80276-ACRRBS16760
Крыса VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80276-CFRBS14710
Крыса VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80276-CHRBS14710
Крыса VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80276-CMRBS14710
Крыса VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80276-CYRBS14710
Крыса VE-Cadherin/CD144 Джин клон кДНК в вектор клонированияRG80276-GRBS5130
Крыса VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80276-NFRBS14710
Крыса VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80276-NHRBS14710
Крыса VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80276-NMRBS14710
Крыса VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80276-NYRBS14710
Крыса VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмидыRG80276-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Cadherins (Calcium dependent adhesion molecules) are a class of transmembrane proteins. Cadherin-5, also known as VE-cadherin, CDH5 and CD144, an endothelial specific cell-cell adhesion molecule, plays a pivotal role in the formation, maturation and remodeling of the vascular wall. VE-Cadherin is widely considered to be specific for vascular endothelia in which it is either the sole or the predominant cadherin, often co-existing with N-cadherin. This specificity of VE-cadherin for vascular endothelial cells is important not only in blood and lymph vessel biology and medicine, but also for cell-type-based diagnoses, notably those of metastatic tumors. As a classical cadherin, VE-Cadherin links endothelial cells together by homophilic interactions mediated by its extracellular part and associates intracellularly with the actin cytoskeleton via catenins. Mechanisms that regulate VE-cadherin-mediated adhesion are important for the control of vascular permeability and leukocyte extravasation. In addition to its adhesive functions, VE-Cadherin regulates various cellular processes such as cell proliferation and apoptosis and modulates vascular endothelial growth factor receptor functions. Consequently, VE-cadherin is essential during embryonic angiogenesis.

Ссылки
  • Taveau JC, et al. (2008) Structure of artificial and natural VE-cadherin-based adherens junctions. Biochem Soc Trans. 36(Pt 2): 189-93.
  • Vestweber D. (2008) VE-cadherin: the major endothelial adhesion molecule controlling cellular junctions and blood vessel formation. Arterioscler Thromb Vasc Biol. 28(2): 223-32.
  • Gavard J. (2009) Breaking the VE-cadherin bonds. FEBS Lett. 583(1): 1-6.
  • Vestweber D, et al. (2009) Cell adhesion dynamics at endothelial junctions: VE-cadherin as a major player. Trends Cell Biol. 19(1): 8-15.
  • Boda-Heggemann J, et al. (2009) Beyond vessels: occurrence and regional clustering of vascular endothelial (VE-)cadherin-containing junctions in non-endothelial cells. Cell Tissue Res. 335(1): 49-65.
  • Size / Price
    Каталог: RG80276-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».