After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса N-Cadherin/CD325/CDH2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CDH2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_031333.1
Размер кДНК:2721bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus cadherin 2 with C terminal His tag.
Синоним гена:N-cadherin, Cdh2
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса N-Cadherin/CD325/CDH2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса N-Cadherin/CD325/CDH2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80275-ACGRBS22240
Крыса N-Cadherin/CD325/CDH2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80275-ACRRBS22240
Крыса N-Cadherin/CD325/CDH2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80275-CFRBS20190
Крыса N-Cadherin/CD325/CDH2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80275-CHRBS20190
Крыса N-Cadherin/CD325/CDH2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80275-CMRBS20190
Крыса N-Cadherin/CD325/CDH2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80275-CYRBS20190
Крыса N-Cadherin/CD325/CDH2 Джин клон кДНК в вектор клонированияRG80275-GRBS5130
Крыса N-Cadherin/CD325/CDH2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80275-NFRBS20190
Крыса N-Cadherin/CD325/CDH2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80275-NHRBS20190
Крыса N-Cadherin/CD325/CDH2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80275-NMRBS20190
Крыса N-Cadherin/CD325/CDH2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80275-NYRBS20190
Крыса N-Cadherin/CD325/CDH2 Джин ORF экспрессии кДНК клона плазмидыRG80275-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Cadherins are calcium dependent cell adhesion proteins, and they preferentially interact with themselves in a homophilic manner in connecting cells. Cadherin 2 (CDH2), also known as N-Cadherin (neuronal) (NCAD), is a single-pass tranmembrane protein and a cadherin containing 5 cadherin domains. N-Cadherin displays a ubiquitous expression pattern but with different expression levels between endocrine cell types. CDH2 (NCAD) has been shown to play an essential role in normal neuronal development, which is implicated in an array of processes including neuronal differentiation and migration, and axon growth and fasciculation. In addition, N-Cadherin expression was upregulated in human HSC during activation in culture, and function or expression blocking of N-Cadherin promoted apoptosis. During apoptosis, N-Cadherin was cleaved into 20-100 kDa fragments. It may provide a novel target for therapies that are directed toward intimal proliferative disorders, including restenosis and vascular bypass graft failure. N-Cadherin is associated with tumor aggressiveness and metastatic potential and may contribute to tumor progression.

Ссылки
  • Jones M, et al. (2002) N-cadherin upregulation and function in response of smooth muscle cells to arterial injury. Arterioscler Thromb Vasc Biol. 22(12): 1972-7.
  • Nagi C, et al. (2005) N-cadherin expression in breast cancer: correlation with an aggressive histologic variant--invasive micropapillary carcinoma. Breast Cancer Res Treat. 94(3): 225-35.
  • Schrick C, et al. (2007) N-cadherin regulates cytoskeletally associated IQGAP1/ERK signaling and memory formation. Neuron. 55(5): 786-98.
  • Li K, et al. (2010) Downregulation of N-cadherin expression inhibits invasiveness, arrests cell cycle and induces cell apoptosis in esophageal squamous cell carcinoma. Cancer Invest. 28(5): 479-86.
  • Size / Price
    Каталог: RG80275-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».