Cadherin 17 / CDH17 cDNA ORF Clone, Rat, C-GFPSpark® tag

Price:
Size:
Number:

Cadherin 17 / CDH17 cDNA ORF Clone, Rat, C-GFPSpark® tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2484 bp
Description
Full length Clone DNA of Rat cadherin 17 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Cadherin 17 / CDH17 Background Information

Cadherin-17 or LI-cadherin is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Cadherin-17/LI-cadherin is a cadherin-like protein consisting of an extracellular region, 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing of the encoding gene results in multiple transcript variants. Cadherin-17/LI-cadherin preferentially interact with themselves in a homophilic manner in connecting cells. Cadherin-17 may thus contribute to the sorting of heterogeneous cell types and have a role in the morphological organization of liver and intestine. It's also involved in intestinal peptide transport. Experiments have reported the association between Cadherin-17/LI-cadherin and gastric cancer. Cadherin-17/LI-cadherin expression was detected in 63/94 of gastric adenocarcinomas in addition to intestinal metaplasia. The expression of Cadherin-17 tended to be associated with intestinal type carcinoma, and carcinomas with Cadherin-17 expression was significantly more frequent in advanced stage cases than in early stage. Cadherin-17 is also a useful immunohistochemical marker for diagnosis of adenocarcinomas of the digestive system.
Full Name
cadherin 17, LI cadherin (liver-intestine)
References
  • Liu LX, et al. (2009) Targeting cadherin-17 inactivates Wnt signaling and inhibits tumor growth in liver carcinoma. Hepatology. 50(5): 1453-63.
  • Ito R, et al. (2005) Clinicopathological significant and prognostic influence of cadherin-17 expression in gastric cancer. Virchows Arch. 447(4): 717-22.
  • Horsfield J, et al. (2002) Cadherin-17 is required to maintain pronephric duct integrity during zebrafish development. Mech Dev. 115(1-2): 15-26.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait