Быстрый заказ

Крыса Cadherin-17/LI-cadherin Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Крыса CDH17 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_053977.2
Размер кДНК:2484bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus cadherin 17 with N terminal His tag.
Синоним гена:Cdh17
Виды:Rat
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CDH17 qPCR primers for gene expression analysis, RP300262 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса Cadherin-17/LI-cadherin Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса Cadherin-17/LI-cadherin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80283-ACGRBS16760
Крыса Cadherin-17/LI-cadherin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80283-ACRRBS16760
Крыса Cadherin-17/LI-cadherin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80283-CFRBS14710
Крыса Cadherin-17/LI-cadherin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80283-CHRBS14710
Крыса Cadherin-17/LI-cadherin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80283-CMRBS14710
Крыса Cadherin-17/LI-cadherin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80283-CYRBS14710
Крыса Cadherin-17/LI-cadherin Джин клон кДНК в вектор клонированияRG80283-GRBS5130
Крыса Cadherin-17/LI-cadherin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80283-NFRBS14710
Крыса Cadherin-17/LI-cadherin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80283-NHRBS14710
Крыса Cadherin-17/LI-cadherin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80283-NMRBS14710
Крыса Cadherin-17/LI-cadherin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80283-NYRBS14710
Крыса Cadherin-17/LI-cadherin Джин ORF экспрессии кДНК клона плазмидыRG80283-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Cadherin-17 or LI-cadherin is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Cadherin-17/LI-cadherin is a cadherin-like protein consisting of an extracellular region, 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing of the encoding gene results in multiple transcript variants. Cadherin-17/LI-cadherin preferentially interact with themselves in a homophilic manner in connecting cells. Cadherin-17 may thus contribute to the sorting of heterogeneous cell types and have a role in the morphological organization of liver and intestine. It's also involved in intestinal peptide transport. Experiments have reported the association between Cadherin-17/LI-cadherin and gastric cancer. Cadherin-17/LI-cadherin expression was detected in 63/94 of gastric adenocarcinomas in addition to intestinal metaplasia. The expression of Cadherin-17 tended to be associated with intestinal type carcinoma, and carcinomas with Cadherin-17 expression was significantly more frequent in advanced stage cases than in early stage. Cadherin-17 is also a useful immunohistochemical marker for diagnosis of adenocarcinomas of the digestive system.

Ссылки
  • Liu LX, et al. (2009) Targeting cadherin-17 inactivates Wnt signaling and inhibits tumor growth in liver carcinoma. Hepatology. 50(5): 1453-63.
  • Ito R, et al. (2005) Clinicopathological significant and prognostic influence of cadherin-17 expression in gastric cancer. Virchows Arch. 447(4): 717-22.
  • Horsfield J, et al. (2002) Cadherin-17 is required to maintain pronephric duct integrity during zebrafish development. Mech Dev. 115(1-2): 15-26.
  • Size / Price
    Каталог: RG80283-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».