Быстрый заказ

Text Size:AAA

Крыса Cadherin-15/CDH15 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CDH15 Информация о продукте «Клон cDNA»
Размер кДНК:2355bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus cadherin 15 with N terminal His tag.
Синоним гена:Cdh15
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса Cadherin-15/CDH15 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса Cadherin-15/CDH15 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80281-ACGRBS16760
Крыса Cadherin-15/CDH15 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80281-ACRRBS16760
Крыса Cadherin-15/CDH15 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80281-CFRBS14710
Крыса Cadherin-15/CDH15 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80281-CHRBS14710
Крыса Cadherin-15/CDH15 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80281-CMRBS14710
Крыса Cadherin-15/CDH15 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80281-CYRBS14710
Крыса Cadherin-15/CDH15 Джин клон кДНК в вектор клонированияRG80281-GRBS5130
Крыса Cadherin-15/CDH15 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80281-NFRBS14710
Крыса Cadherin-15/CDH15 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80281-NHRBS14710
Крыса Cadherin-15/CDH15 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80281-NMRBS14710
Крыса Cadherin-15/CDH15 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80281-NYRBS14710
Крыса Cadherin-15/CDH15 Джин ORF экспрессии кДНК клона плазмидыRG80281-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Cadherin-15, also known as CDH15, is a member of the cadherin superfamily. Cadherins consist of an extracellular domain containing 5 cadherin domains, a transmembrane region, and a conserved cytoplasmic domain. Cadherins are calcium dependent cell adhesion proteins. They preferentially interact with themselves in a homophilic manner in connecting cells; cadherins may thus contribute to the sorting of heterogeneous cell types. Cadherin-15 contains 5 cadherin domains. It is expressed in some normal epithelial tissues and in some carcinoma cell lines. Defects in CDH3 are the cause of ectodermal dysplasia with ectrodactyly and macular dystrophy (EEM), also known as EEM syndrome, Albrectsen-Svendsen syndrome or Ohdo-Hirayama-Terawaki syndrome. Ectodermal dysplasia defines a heterogeneous group of disorders due to abnormal development of two or more ectodermal structures. EEM is an autosomal recessive condition characterized by features of ectodermal dysplasia such as sparse eyebrows and scalp hair, and selective tooth agenesis associated with macular dystrophy and ectrodactyly.

  • Shibata T, et al. (1997) Identification of human cadherin-14, a novel neurally specific type II cadherin, by protein interaction cloning. J Biol Chem. 272(8):5236-40.
  • Bornemann A, et al. (1994) Immunocytochemistry of M-cadherin in mature and regenerating rat muscle. Anat Rec. 239(2):119-25.
  • Donalies M, et al. (1991) Expression of M-cadherin, a member of the cadherin multigene family, correlates with differentiation of skeletal muscle cells. Proc Natl Acad Sci. 88(18):8024-8.
  • Size / Price
    Каталог: RG80281-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.