Быстрый заказ

Text Size:AAA

Крыса CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CDH13 Информация о продукте «Клон cDNA»
Размер кДНК:2145bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus cadherin 13 with C terminal His tag.
Синоним гена:Cdht, Tcad, MGC93172, T-cadherin, Cdh13
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80280-ACGRBS16760
Крыса CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80280-ACRRBS16760
Крыса CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80280-CFRBS14710
Крыса CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80280-CHRBS14710
Крыса CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80280-CMRBS14710
Крыса CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80280-CYRBS14710
Крыса CDH13 / Cadherin-13 / H Cadherin Джин клон кДНК в вектор клонированияRG80280-GRBS5130
Крыса CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80280-NFRBS14710
Крыса CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80280-NHRBS14710
Крыса CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80280-NMRBS14710
Крыса CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80280-NYRBS14710
Крыса CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмидыRG80280-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CDH13, also known as cadherin-13 and H Cadherin, is a member of the cadherin superfamily. CDH13 acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. CDH13 is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. CDH13 gene is hypermethylated in many types of cancer.

  • Hart AB. et al., 2012, PLoS One. 7 (8): e42646.
  • Xu J. et al., 2012, BMC Cancer. 12: 243.
  • Jo J. et al., 2012, Obesity (Silver Spring). 20 (8): 1683-7.
  • Size / Price
    Каталог: RG80280-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.