After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса Cadherin-12/CDH12 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CDH12 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_229369.5
Размер кДНК:2385bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus cadherin 12 with C terminal His tag.
Синоним гена:RGD1566350, Cdh12
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса Cadherin-12/CDH12 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса Cadherin-12/CDH12 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80279-ACGRBS16760
Крыса Cadherin-12/CDH12 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80279-ACRRBS16760
Крыса Cadherin-12/CDH12 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80279-CFRBS14710
Крыса Cadherin-12/CDH12 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80279-CHRBS14710
Крыса Cadherin-12/CDH12 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80279-CMRBS14710
Крыса Cadherin-12/CDH12 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80279-CYRBS14710
Крыса Cadherin-12/CDH12 Джин клон кДНК в вектор клонированияRG80279-GRBS5130
Крыса Cadherin-12/CDH12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80279-NFRBS14710
Крыса Cadherin-12/CDH12 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80279-NHRBS14710
Крыса Cadherin-12/CDH12 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80279-NMRBS14710
Крыса Cadherin-12/CDH12 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80279-NYRBS14710
Крыса Cadherin-12/CDH12 Джин ORF экспрессии кДНК клона плазмидыRG80279-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Classic Cadherins represent a family of calcium-dependent homophilic cell-cell adhesion molecules. They confer strong adhesiveness to animal cells when they are anchored to the actin cytoskeleton via their cytoplasmic binding partners, catenins. The cadherin/catenin adhesion system plays key roles in the morphogenesis and function of the vertebrate and invertebrate nervous systems. Furthermore, this system is involved in synaptic plasticity. Recent studies on the role of individual cadherin subtypes at synapses indicate that individual cadherin subtypes play their own unique role to regulate synaptic activities. Type II (atypical) cadherins are defined based on their lack of an HAV cell adhesion recognition sequence specific to type I cadherins. It has been observed that cells containing a specific cadherin subtype tend to cluster together to the exclusion of other types, both in cell culture and during development. Cadherin-12 also known as CDH12, is a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Cadherin-12 appears to be expressed specifically in the brain and its temporal pattern of expression would be consistent with a role during a critical period of neuronal development, perhaps specifically during synaptogenesis.

Ссылки
  • Tanihara H, et al. (1994) Cloning of five human cadherins clarifies characteristic features of cadherin extracellular domain and provides further evidence for two structurally different types of cadherin. Cell Adhes Commun. 2(1): 15-26.
  • Suzuki SC, et al. (2008) Cadherins in neuronal morphogenesis and function. Dev Growth Differ. 50 Suppl 1: S119-30.
  • Size / Price
    Каталог: RG80279-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».