Быстрый заказ

Крыса E-Cadherin/CDH1/E-cad/CD324 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

  • other Green fluorescent protein / GFP Gene Plasmid Map 5610
ПаспортОбзорыСвязанные продуктыПротоколы
Крыса CDH1 Информация о продукте «Клон cDNA»
Размер кДНК:2706 bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus cadherin 1 with C terminal His tag.
Синоним гена:Cdh1
Участок рестрикции:KpnI + XbaI(6kb+2.71kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with CDH1 qPCR primers for gene expression analysis, RP300255 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса E-Cadherin/CDH1/E-cad/CD324 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса E-Cadherin/CDH1/E-cad/CD324 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80274-ACGRBS22240
Крыса E-Cadherin/CDH1/E-cad/CD324 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80274-ACRRBS22240
Крыса E-Cadherin/CDH1/E-cad/CD324 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80274-CFRBS20190
Крыса E-Cadherin/CDH1/E-cad/CD324 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80274-CHRBS20190
Крыса E-Cadherin/CDH1/E-cad/CD324 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80274-CMRBS20190
Крыса E-Cadherin/CDH1/E-cad/CD324 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80274-CYRBS20190
Крыса E-Cadherin/CDH1/E-cad/CD324 Джин клон кДНК в вектор клонированияRG80274-GRBS5130
Крыса E-Cadherin/CDH1/E-cad/CD324 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80274-NFRBS20190
Крыса E-Cadherin/CDH1/E-cad/CD324 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80274-NHRBS20190
Крыса E-Cadherin/CDH1/E-cad/CD324 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80274-NMRBS20190
Крыса E-Cadherin/CDH1/E-cad/CD324 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80274-NYRBS20190
Крыса E-Cadherin/CDH1/E-cad/CD324 Джин ORF экспрессии кДНК клона плазмидыRG80274-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Cadherins are calcium-dependent cell adhesion proteins which preferentially interact with themselves in a homophilic manner in connecting cells, and thus may contribute to the sorting of heterogeneous cell type. E-cadherin (E-Cad), also known as CDH1 and CD324, is a calcium-dependent cell adhesion molecule the intact function of which is crucial for the establishment and maintenance of epithelial tissue polarity and structural integrity. Mutations in CDH1 occur in diffuse type gastric cancer, lobular breast cancer, and endometrial cancer. In human cancers, partial or complete loss of E-cadherin expression correlates with malignancy. During apoptosis or with calcium influx, E-Cad is cleaved by the metalloproteinase to produce fragments of about 38 kDa (E-CAD/CTF1), 33 kDa (E-CAD/CTF2) and 29 kDa (E-CAD/CTF3), respectively. E-Cad has been identified as a potent invasive suppressor, as downregulation of E-cadherin expression is involved in dysfunction of the cell-cell adhesion system, and often correlates with strong invasive potential and poor prognosis of human carcinomas.

  • Wang HD, et al. (2004) CDH1 germline mutation in hereditary gastric carcinoma. World J Gastroenterol. 10(21): 3088-93.
  • Masterson J, et al. (2007) Posttranslational truncation of E-cadherin and significance for tumour progression. Cells Tissues Organs. 185(1-3): 175-9.
  • Mrgineanu E, et al. (2008) Correlation between E-cadherin abnormal expressions in different types of cancer and the process of metastasis. Rev Med Chir Soc Med Nat Iasi. 112(2): 432-6.
  • Size / Price
    Каталог: RG80274-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.