Быстрый заказ

Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса CD99 Информация о продукте «Клон cDNA»
    Размер кДНК:498bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus CD99 antigen with C terminal His tag.
    Синоним гена:Cd99
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with CD99 qPCR primers for gene expression analysis, RP300296 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80325-ACGRBS15400
    Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80325-ACRRBS15400
    Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80325-CFRBS13340
    Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80325-CHRBS13340
    Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80325-CMRBS13340
    Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80325-CYRBS13340
    Крыса CD99 Джин клон кДНК в вектор клонированияRG80325-GRBS5130
    Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80325-NFRBS13340
    Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80325-NHRBS13340
    Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80325-NMRBS13340
    Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80325-NYRBS13340
    Крыса CD99 Джин ORF экспрессии кДНК клона плазмидыRG80325-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD99 is a transmembrane protein expressed on most hematopoietic cells, endothelial cells and at the borders between confluent cells. CD99 is also found expressed in the development of normal ovary and testis as well as in 25 sex cord-stromal tumors, 7 epithelial neoplasms, and 6 germ cell tumors. CD99 may be a useful marker for sex cord-stromal tumors and that its degree of reactivity correlates with the degree of differentiation in Sertoli-Leydig cell tumors. Additionally, CD99 might aid in distinguishing granulose cell tumors of the ovary from poorly differentiated carcinomas and it has been reported to be a sensitive and specific marker for Ewing's sarcoma and primitive neuroectodermal tumor.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Schenkel AR, et al. (2002) CD99 plays a major role in the migration of monocytes through endothelial junctions. Nature Immunology. 3: 143 - 50.
  • Gordon MD, et al. (1998) CD99, keratin, and vimentin staining of sex cord-stromal tumors, normal ovary, and testis. Mod Pathol. 11 (8): 769-73.
  • Size / Price
    Каталог: RG80325-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.