Быстрый заказ

Text Size:AAA

Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD99 Информация о продукте «Клон cDNA»
Размер кДНК:498bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus CD99 antigen with C terminal HA tag.
Синоним гена:Cd99
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80325-ACGRBS15400
Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80325-ACRRBS15400
Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80325-CFRBS13340
Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80325-CHRBS13340
Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80325-CMRBS13340
Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80325-CYRBS13340
Крыса CD99 Джин клон кДНК в вектор клонированияRG80325-GRBS5130
Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80325-NFRBS13340
Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80325-NHRBS13340
Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80325-NMRBS13340
Крыса CD99 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80325-NYRBS13340
Крыса CD99 Джин ORF экспрессии кДНК клона плазмидыRG80325-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD99 is a transmembrane protein expressed on most hematopoietic cells, endothelial cells and at the borders between confluent cells. CD99 is also found expressed in the development of normal ovary and testis as well as in 25 sex cord-stromal tumors, 7 epithelial neoplasms, and 6 germ cell tumors. CD99 may be a useful marker for sex cord-stromal tumors and that its degree of reactivity correlates with the degree of differentiation in Sertoli-Leydig cell tumors. Additionally, CD99 might aid in distinguishing granulose cell tumors of the ovary from poorly differentiated carcinomas and it has been reported to be a sensitive and specific marker for Ewing's sarcoma and primitive neuroectodermal tumor.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Schenkel AR, et al. (2002) CD99 plays a major role in the migration of monocytes through endothelial junctions. Nature Immunology. 3: 143 - 50.
  • Gordon MD, et al. (1998) CD99, keratin, and vimentin staining of sex cord-stromal tumors, normal ovary, and testis. Mod Pathol. 11 (8): 769-73.
  • Size / Price
    Каталог: RG80325-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.