After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса CD96/TACTILE Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD96 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001025032.1
Размер кДНК:1812bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus CD96 molecule with N terminal His tag.
Синоним гена:Cd96
Виды:Rat
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса CD96/TACTILE Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса CD96/TACTILE Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80338-ACGRBS16760
Крыса CD96/TACTILE Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80338-ACRRBS16760
Крыса CD96/TACTILE Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80338-CFRBS14710
Крыса CD96/TACTILE Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80338-CHRBS14710
Крыса CD96/TACTILE Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80338-CMRBS14710
Крыса CD96/TACTILE Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80338-CYRBS14710
Крыса CD96/TACTILE Джин клон кДНК в вектор клонированияRG80338-GRBS5130
Крыса CD96/TACTILE Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80338-NFRBS14710
Крыса CD96/TACTILE Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80338-NHRBS14710
Крыса CD96/TACTILE Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80338-NMRBS14710
Крыса CD96/TACTILE Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80338-NYRBS14710
Крыса CD96/TACTILE Джин ORF экспрессии кДНК клона плазмидыRG80338-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. The CD155 ligand CD96 is a member of the Ig superfamily. It's a immunoglobulin-like protein tentatively allocated to the repertoire of human NK receptors. NK cells recognize poliovirus receptor (PVR), a nectins and nectin-like protein family member serve to mediate cell-cell adhesion, cell migration, with the presence of an additional receptor, CD96. CD96 promotes NK cell adhesion to target cells expressing PVR, stimulates cytotoxicity of activated NK cells, and mediates acquisition of PVR from target cells. The effect the cells with mutated CD96 protein lost adhesion and growth activities indicates that CD96 mutations may cause a form of the C syndrome by interfering with cell adhesion and growth.

Ссылки
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Anja Fuchs, et al. (2004) Cutting Edge: CD96 (Tactile) Promotes NK Cell-Target Cell Adhesion by Interacting with the Poliovirus Receptor (CD155). The Journal of Immunology.172 (7): 3994-8.
  • Seth S, et al.(2007) The murine pan T cell marker CD96 is an adhesion receptor for CD155 and nectin-1. Biochemical and Biophysical Research Communications. 364 (4): 959-65.
  • Size / Price
    Каталог: RG80338-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».