Быстрый заказ

Крыса CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Крыса CD8A Информация о продукте «Клон cDNA»
Размер кДНК:711bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus CD8a molecule with C terminal His tag.
Синоним гена:Cd8a
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
( We provide with CD8A qPCR primers for gene expression analysis, RP300390 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80285-ACGRBS15400
Крыса CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80285-ACRRBS15400
Крыса CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80285-CFRBS13340
Крыса CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80285-CHRBS13340
Крыса CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80285-CMRBS13340
Крыса CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80285-CYRBS13340
Крыса CD8/CD8 alpha/Leu-2 Джин клон кДНК в вектор клонированияRG80285-GRBS5130
Крыса CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80285-NFRBS13340
Крыса CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80285-NHRBS13340
Крыса CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80285-NMRBS13340
Крыса CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80285-NYRBS13340
Крыса CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмидыRG80285-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Human T-cell surface glycoprotein CD8 alpha chain, also known as CD8a, is a single-pass type I  membrane protein. The CD8 glycoprotein is expressed by thymocytes, mature T cells and natural killer (NK) cells and has been implicated in the recognition of monomorphic determinants on major histocompatibility complex (MHC) Class I antigens, and in signal transduction during the course of T-cell activation. Both human and rodent CD8 antigens are comprised of two distinct polypeptide chains, alpha and beta. The Ig domains of CD8 alpha are involved in controlling the ability of CD8 to be expressed. Mutation of B- and F-strand cysteine residues in CD8 alpha reduced the ability of the protein to fold properly and, therefore, to be expressed. Defects in CD8A are a cause of familial CD8 deficiency. Familial CD8 deficiency is a novel autosomal recessive immunologic defect characterized by absence of CD8+ cells, leading to recurrent bacterial infections.

References Devine, L. et al., 2000, J Immunol. 164 (2): 833-8. Arcaro, A. et al., 2000, J Immunol. 165 (4): 2068-76. Saha, K. et al., 2001, Nat Med. 7 (1): 65-72. Romero, P. et al., 2005, Eur J Immunol. 35 (11): 3092-4.
Size / Price
Каталог: RG80285-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.