CD83 cDNA ORF Clone, Rat, C-HA tag

Price:
Size:
Number:

CD83 cDNA ORF Clone, Rat, C-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
592 bp
Description
Full length Clone DNA of Rat Cd83 molecule with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD83 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 32 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD83 is considered as a marker of mature dendritic cells as well as an adhesion receptor that binds to resting monocytes and a subset of activated CD8+ T cells. In certain conditions, CD83 tended to dimerize or even multimerize through its aberrant intermolecular disulfide bonds. The injection of CD83-Ig can significantly enhaunce the rate of tumor growth and inhibit the T cell growth.
Full Name
CD83 molecule
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Scholler N, et al.(2002) Cutting Edge: CD83 Regulates the Development of Cellular Immunity. The Journal of Immunology. 168 (6): 2599-602.
  • Lechmann M, et al.(2002) CD83 on dendritic cells: more than just a marker for maturation. Trends in immunology. 23(6): 273-5.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait