After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD82 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_031797.2
Размер кДНК:801bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd82 molecule with C terminal HA tag.
Синоним гена:Kai1, Cd82
Виды:Rat
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80332-ACGRBS15400
Крыса CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80332-ACRRBS15400
Крыса CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80332-CFRBS13340
Крыса CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80332-CHRBS13340
Крыса CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80332-CMRBS13340
Крыса CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80332-CYRBS13340
Крыса CD82/KAI-1 Джин клон кДНК в вектор клонированияRG80332-GRBS5130
Крыса CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80332-NFRBS13340
Крыса CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80332-NHRBS13340
Крыса CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80332-NMRBS13340
Крыса CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80332-NYRBS13340
Крыса CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмидыRG80332-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CD82, also known as KAI-1, structurally belongs to tetraspanin family while categorised as metastasis suppressor gene on functional grounds. KAI1/CD82 is localized on cell membrane and form interactions with other tetraspanins, integrins and chemokines which are respectively responsible for cell migration, adhesion and signalling. Downregulation of CD82 expression is associated with the advanced stages of many human cancers and correlates with the acquisition of metastatic potential. Recent studies suggest that complex mechanisms underlie CD82 loss of function, including altered transcriptional regulation, splice variant production and post-translational protein modifications, and indicate a central role for CD82 in controlling metastasis as a 'molecular facilitator'. The loss of KAI1/CD82 expression in invasive and metastatic cancers is due to a complex, epigenetic mechanism that probably involves transcription factors such as NFkappaB, p53, and beta-catenin. A loss of KAI1 expression is also associated with the advanced stages of many human malignancies and results in the acquisition of invasive and metastatic capabilities by tumour cells. Thus, KAI1/CD82 is regarded as a wide-spectrum tumor metastasis suppressor.

Ссылки
  • Malik FA, et al. (2009) KAI-1/CD82, the molecule and clinical implication in cancer and cancer metastasis. Histol Histopathol. 24(4): 519-30.
  • Liu WM, et al. (2006) KAI1/CD82, a tumor metastasis suppressor. Cancer Lett. 240(2): 183-94.
  • Tonoli H, et al. (2006) CD82 metastasis suppressor gene: a potential target for new therapeutics? Trends Mol Med. 11(12): 563-70.
  • Jackson P, et al. (2005) KAI1 tetraspanin and metastasis suppressor. Int J Biochem Cell Biol. 37(3): 530-4.
  • Size / Price
    Каталог: RG80332-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».