After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD81 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC060583.1
Размер кДНК:711bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd81 molecule with N terminal His tag.
Синоним гена:Tapa1, Cd81
Виды:Rat
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80331-ACGRBS15400
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80331-ACRRBS15400
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80331-CFRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80331-CHRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80331-CMRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80331-CYRBS13340
Крыса CD81/TAPA1 Джин клон кДНК в вектор клонированияRG80331-GRBS5130
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80331-NFRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80331-NHRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80331-NMRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80331-NYRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмидыRG80331-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CD81, also known as TAPA-1, belongs to the transmembrane 4 superfamily, also known as the tetraspanin family. Members of this family mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility.CD81 is a widely expressed cell-surface protein involved in an astonishing variety of biologic responses. It is related to adhesion, morphology, activation, proliferation, and differentiation of B, T, and other cells. On B cells CD81 is part of a complex with CD21, CD19, and Leu13. This complex reduces the threshold for B cell activation via the B cell receptor by bridging Ag specific recognition and CD21-mediated complement recognition.

Ссылки
  • Petracca R. et al., 2000, J Virol. 74 (10): 4824-30.
  • Bartosch B. et al., 2003, The Journal of Biological Chemistry. 278 (43): 41624-30.
  • Clark KL. et al., 2001, Journal of Immunology. 167 (9): 5115-21.
  • Size / Price
    Каталог: RG80331-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».