Быстрый заказ

Text Size:AAA

Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD81 Информация о продукте «Клон cDNA»
Размер кДНК:711bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd81 molecule with N terminal His tag.
Синоним гена:Tapa1, Cd81
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80331-ACGRBS15400
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80331-ACRRBS15400
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80331-CFRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80331-CHRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80331-CMRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80331-CYRBS13340
Крыса CD81/TAPA1 Джин клон кДНК в вектор клонированияRG80331-GRBS5130
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80331-NFRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80331-NHRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80331-NMRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80331-NYRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмидыRG80331-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD81, also known as TAPA-1, belongs to the transmembrane 4 superfamily, also known as the tetraspanin family. Members of this family mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility.CD81 is a widely expressed cell-surface protein involved in an astonishing variety of biologic responses. It is related to adhesion, morphology, activation, proliferation, and differentiation of B, T, and other cells. On B cells CD81 is part of a complex with CD21, CD19, and Leu13. This complex reduces the threshold for B cell activation via the B cell receptor by bridging Ag specific recognition and CD21-mediated complement recognition.

  • Petracca R. et al., 2000, J Virol. 74 (10): 4824-30.
  • Bartosch B. et al., 2003, The Journal of Biological Chemistry. 278 (43): 41624-30.
  • Clark KL. et al., 2001, Journal of Immunology. 167 (9): 5115-21.
  • Size / Price
    Каталог: RG80331-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.